Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 297

1.
Value/Rank Plot

1110008P14Rik - Receptor activator of NF-κB ligand effect on bone marrow-derived macrophage cells: time course

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS5422, NM_198001
DataSet type:
Expression profiling by array, count, 8 samples
2.
Value/Rank Plot

1110008P14Rik - Human Epidermal Growth Factor Receptor 2-positive breast cancer MMTV-Her2/Neu murine model: primary and secondary mammary tumors

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS4099, NM_198001
DataSet type:
Expression profiling by array, count, 16 samples
3.
Value/Rank Plot

1110008P14Rik - High, Normal, and Low Anxiety: multiple brain regions

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6481, 6250576 (ID_REF), GDS4002, NM_198001, 1110008P14Rik (CLONE ID)
DataSet type:
Expression profiling by array, count, 75 samples
4.
Value/Rank Plot

1110008P14Rik - Progranulin deficiency effect on various brain regions: time course

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS5501, NM_198001
DataSet type:
Expression profiling by array, transformed count, 99 samples
5.
Value/Rank Plot

1110008P14Rik - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS3582, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, count, 12 samples
6.
Value/Rank Plot

1110008P14Rik - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS3900, NM_198001
DataSet type:
Expression profiling by array, count, 198 samples
7.
Value/Rank Plot

1110008P14Rik - MPSS transcriptome analysis project

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL1010, GATCCTAGTGGGTCTACCAG (ID_REF), GDS868, NM_198001
DataSet type:
Expression profiling by MPSS, count, 87 samples
8.
Value/Rank Plot

1110008P14Rik - Lymphotoxin-β receptor agonist antibody effect on lipopolysaccharide-stimulated embryonic fibroblasts

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS5655, NM_198001
DataSet type:
Expression profiling by array, count, 4 samples
9.
Value/Rank Plot

1110008P14Rik - Restless Legs Syndrome model: adult whole brain

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS5299, NM_198001
DataSet type:
Expression profiling by array, count, 7 samples
10.
Value/Rank Plot

1110008P14Rik - Estradiol effect on the uterus: time course

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL891, 7272 (ID_REF), GDS2208, NM_198001, A_51_P207153 (SPOT ID)
DataSet type:
Expression profiling by array, log10 ratio, 10 samples
11.
Value/Rank Plot

1110008P14Rik - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS5648, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, count, 11 samples
12.
Value/Rank Plot

1110008P14Rik - Lipopolysaccharide effect on fatty acid-loaded peritoneal macrophages in vitro

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS5311, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, transformed count, 15 samples
13.
Value/Rank Plot

1110008P14Rik - Negative elongation factor B subunit deficiency effect on the heart

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS5302, NM_198001
DataSet type:
Expression profiling by array, count, 6 samples
14.
Value/Rank Plot

1110008P14Rik - Kelch-like family member 40 deficiency effect on the skeletal muscle

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS5295, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, count, 6 samples
15.
Value/Rank Plot

1110008P14Rik - Small-molecule inhibition of BRDT effect on testis

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS5172, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, count, 6 samples
16.
Value/Rank Plot

1110008P14Rik - Claudin 18 deficiency effect on the lung

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS4961, NM_198001
DataSet type:
Expression profiling by array, transformed count, 7 samples
17.
Value/Rank Plot

1110008P14Rik - Heart failure progression model: non-infarcted ventricular tissue

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL891, 7272 (ID_REF), GDS3386, NM_198001, A_51_P207153 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 20 samples
18.
Value/Rank Plot

1110008P14Rik - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS5293, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, count, 11 samples
19.
Value/Rank Plot

1110008P14Rik - B-cell leukemia/lymphoma 11B overexpression effect on brain striatal cells in vitro

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6885, ILMN_1225594 (ID_REF), GDS5180, NM_198001
DataSet type:
Expression profiling by array, transformed count, 8 samples
20.
Value/Rank Plot

1110008P14Rik - Maternal western diet effect on post-weaning low-fat diet fed offspring liver

Annotation:
1110008P14Rik, RIKEN cDNA 1110008P14 gene
Organism:
Mus musculus
Reporter:
GPL6887, ILMN_1225594 (ID_REF), GDS5342, NM_198001, 1110008P14RIK (ORF)
DataSet type:
Expression profiling by array, count, 11 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center