GEO Profiles Links for Nucleotide (Select 255958181) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 316

<< First< Prev

Page of 16

Next >Last >>

Select item 1270749311.

Tsen34 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL4134, 41731 (ID_REF), GDS5461, NM_024168, A_51_P168171 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127074931

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76138982.

Tsen34 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACTGCGTTTCCATGC (ID_REF), GDS878, NM_024168

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7613898

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 573390283.

Tsen34 - Kras G12D heterozygous mutation effect on somatic cell line (Sentrix MouseRef-8)

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL4865, scl0066078.1_97-S (ID_REF), GDS3456, NM_024168

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 57339028

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756705934.

Tsen34 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6481, 1450465 (ID_REF), GDS4002, NM_024168, Leng5 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75670593

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1300104065.

Tsen34 - Lymphotoxin-β receptor agonist antibody effect on lipopolysaccharide-stimulated embryonic fibroblasts

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2628175 (ID_REF), GDS5655, NM_024168

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 130010406

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1277224336.

Tsen34 - Rosiglitazone effect on adipose progenitor cells

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2628175 (ID_REF), GDS5520, NM_024168, TSEN34 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 127722433

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 502386347.

Tsen34 - Reversine effect on myoblast cell line

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL2995, 924677 (ID_REF), GDS3159, NM_024168

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 50238634

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 225813948.

Tsen34 - Various tissues from somatic clones

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL2026, 8394 (ID_REF), GDS1943, NM_024168

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 22581394

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1248407069.

Tsen34 - DPP4A overexpression effect on fibroblast cell line

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2628175 (ID_REF), GDS5400, NM_024168

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124840706

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6403376710.

Tsen34 - SIRT1 deficiency effect on the liver

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P168171 (ID_REF), GDS3666, NM_024168, A_51_P168171 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64033767

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4820783511.

Tsen34 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL4234, 1450465 (ID_REF), GDS3086, NM_024168

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48207835

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3014823412.

Tsen34 - High and low weight gainers: adipose tissue

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL2995, 924677 (ID_REF), GDS2319, NM_024168

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30148234

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747619813.

Tsen34 - MPSS transcriptome analysis project

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACTGCGTTTCCATGC (ID_REF), GDS868, NM_024168

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7476198

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 9181748114.

Tsen34 - Oxidative stress effect on ATF4 knockout embryonic neurons

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6100, 1450465 (ID_REF), GDS3311, NM_024168

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 91817481

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7462133315.

Tsen34 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2628175 (ID_REF), GDS3974, NM_024168, TSEN34 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74621333

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6197785016.

Tsen34 - Eset depletion effect on embryonic stem cell

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL6333, scl0066078.1_97-S (ID_REF), GDS3599, NM_024168, Leng5 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61977850

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4675632817.

Tsen34 - Myc deficiency effect on the embryonic heart

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL4865, scl0066078.1_97-S (ID_REF), GDS3031, NM_024168

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 46756328

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4140428618.

Tsen34 - Nephronophthisis model

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL2897, 101086 (ID_REF), GDS2817, NM_024168

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41404286

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3958702419.

Tsen34 - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL1524, 15224 (ID_REF), GDS2747, NM_024168

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39587024

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13038673120.

Tsen34 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Tsen34, tRNA splicing endonuclease subunit 34

Organism:: Mus musculus

Reporter:: GPL4134, 41731 (ID_REF), GDS5664, NM_024168, A_51_P168171 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130386731

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 255958181) (316)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 316

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity