Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 158

1.
Value/Rank Plot

Ramp2 - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS5201, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 6 samples
2.
Value/Rank Plot

Ramp2 - Light-induced retinal damage

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4980, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 16 samples
3.
Value/Rank Plot

Ramp2 - Developing testis and ovary

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS3995, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 91 samples
4.
Value/Rank Plot

Ramp2 - MPSS transcriptome analysis project

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL1010, GATCATAGCCCCCATCTGCC (ID_REF), GDS868, BC051201
DataSet type:
Expression profiling by MPSS, count, 87 samples
5.
Value/Rank Plot

Ramp2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS5226, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 18 samples
6.
Value/Rank Plot

Ramp2 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS5824, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, count, 18 samples
7.
Value/Rank Plot

Ramp2 - Very low density lipoprotein receptor knockout effect in house dust mite model of asthma: lung

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4999, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 16 samples
8.
Value/Rank Plot

Ramp2 - Pluripotent embryonic stem cells and multipotent adult germline stem cells in 129SV and Stra8-EGFP/Rosa26-LacZ strains

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4170, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 18 samples
9.
Value/Rank Plot

Ramp2 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4898, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 27 samples
10.
Value/Rank Plot

Ramp2 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4317, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 14 samples
11.
Value/Rank Plot

Ramp2 - Polycomb histone methyltransferase Ezh2-deficient hearts: right ventricle and interventricular septum

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4309, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 9 samples
12.
Value/Rank Plot

Ramp2 - Transcription factor c-JUN knockout effect on B lymphoid cells

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4205, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
13.
Value/Rank Plot

Ramp2 - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL11533, 10381298 (ID_REF), GDS4918, NM_019444, BC051201, chr11:101107648-101109564 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 30 samples
14.
Value/Rank Plot

Ramp2 - Adam10 deficiency effect on the epidermis

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS5229, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, count, 8 samples
15.
Value/Rank Plot

Ramp2 - Sex effect on acute coxsackievirus B3-induced myocarditis: heart

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4311, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 12 samples
16.
Value/Rank Plot

Ramp2 - Fra-1 deficient lung response to fibrotic agent bleomycin

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS5078, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 12 samples
17.
Value/Rank Plot

Ramp2 - Histone deacetylase 3 deficiency effect on the heart

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4886, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, count, 8 samples
18.
Value/Rank Plot

Ramp2 - Transcription factor treatment effect on embryonic fibroblasts

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4835, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 28 samples
19.
Value/Rank Plot

Ramp2 - Retinoic acid deficiency effect on embryonic brain

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4836, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 18 samples
20.
Value/Rank Plot

Ramp2 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:
Ramp2, receptor (calcitonin) activity modifying protein 2
Organism:
Mus musculus
Reporter:
GPL6246, 10381298 (ID_REF), GDS4893, NM_019444, AF146523, BC051201, BC069992, AF209906, chr11:101246334-101248250 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center