Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 649

1.
Value/Rank Plot

Cdc42 - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS5628, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
2.
Value/Rank Plot

Cdc42 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL4134, 16499 (ID_REF), GDS5664, NM_009861, A_51_P230977 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
3.
Value/Rank Plot

Cdc42 - Atherosclerosis susceptibility model: macrophages

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL9734, 100116611_TGI_at (ID_REF), GDS4527, NM_009861
DataSet type:
Expression profiling by array, count, 20 samples
4.
Value/Rank Plot

Cdc42 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4517, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
5.
Value/Rank Plot

Cdc42 - Regulatory, pathogenic and control CD4+ T cells

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS3999, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 8 samples
6.
Value/Rank Plot

Cdc42 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS3987, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 26 samples
7.
Value/Rank Plot

Cdc42 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL4134, 16499 (ID_REF), GDS5461, NM_009861, A_51_P230977 (SPOT ID)
DataSet type:
Expression profiling by array, count, 18 samples
8.
Value/Rank Plot

Cdc42 - Liver response to a high fat diet: time course

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4783, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 36 samples
9.
Value/Rank Plot

Cdc42 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6105, ILMN_2762041 (ID_REF), GDS3522, NM_009861
DataSet type:
Expression profiling by array, count, 18 samples
10.
Value/Rank Plot

Cdc42 - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS5824, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 18 samples
11.
Value/Rank Plot

Cdc42 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL7202, A_51_P230977 (ID_REF), GDS5629, NM_009861, A_51_P230977 (SPOT ID)
DataSet type:
Expression profiling by array, count, 4 samples
12.
Value/Rank Plot

Cdc42 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS5456, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 6 samples
13.
Value/Rank Plot

Cdc42 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4948, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 9 samples
14.
Value/Rank Plot

Cdc42 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4946, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 32 samples
15.
Value/Rank Plot

Cdc42 - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS5092, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 13 samples
16.
Value/Rank Plot

Cdc42 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4893, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 12 samples
17.
Value/Rank Plot

Cdc42 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4588, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 44 samples
18.
Value/Rank Plot

Cdc42 - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL6246, 10517559 (ID_REF), GDS4162, NM_009861, AK150563, BC064792, U37720, NM_001243769, L78075, chr4:137319702-137357679 (SPOT ID)
DataSet type:
Expression profiling by array, count, 7 samples
19.
Value/Rank Plot

Cdc42 - Hypertension model: aorta

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL9734, 100116611_TGI_at (ID_REF), GDS3672, NM_009861
DataSet type:
Expression profiling by array, count, 23 samples
20.
Value/Rank Plot

Cdc42 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Cdc42, cell division cycle 42
Organism:
Mus musculus
Reporter:
GPL1010, GATCTTGTGGATTCGTTAGT (ID_REF), GDS878, NM_009861
DataSet type:
Expression profiling by MPSS, count, 6 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center