Format
Items per page
Sort by

Send to:

Choose Destination

Links from Nucleotide

Items: 1 to 20 of 27

1.
Value/Rank Plot

Platr25 - Normal liver developmental stages: embryonic and postnatal

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5818, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, log2 ratio, 11 samples
2.
Value/Rank Plot

Platr25 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL9734, 100084454_TGI_at (ID_REF), GDS4495, BC058422
DataSet type:
Expression profiling by array, count, 9 samples
3.
Value/Rank Plot

Platr25 - Hypertension model: aorta

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL9734, 100084454_TGI_at (ID_REF), GDS3672, BC058422
DataSet type:
Expression profiling by array, count, 23 samples
4.
Value/Rank Plot

Platr25 - MPSS transcriptome analysis project

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL1010, GATCTATGTGTGAAAGCCCA (ID_REF), GDS868, BC058422
DataSet type:
Expression profiling by MPSS, count, 87 samples
5.
Value/Rank Plot

Platr25 - Nephronophthisis model

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL2897, 263007 (ID_REF), GDS2817, BC058422
DataSet type:
Expression profiling by array, count, 6 samples
6.
Value/Rank Plot

Platr25 - Dicer inactivation effect on the embryonic heart

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL5025, 23224 (ID_REF), GDS3033, BC058422
DataSet type:
Expression profiling by array, count, 6 samples
7.
Value/Rank Plot

Platr25 - Atherosclerosis susceptibility model: macrophages

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL9734, 100084454_TGI_at (ID_REF), GDS4527, BC058422
DataSet type:
Expression profiling by array, count, 20 samples
8.
Value/Rank Plot

Platr25 - Spatial and temporal development of mammalian salivary glands

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS3922, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 84 samples
9.
Value/Rank Plot

Platr25 - Hoxa1 deficiency effect on rhombomere regions 3 to 5

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5228, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 8 samples
10.
Value/Rank Plot

Platr25 - Hypertension model: heart

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL9734, 100084454_TGI_at (ID_REF), GDS3673, BC058422
DataSet type:
Expression profiling by array, count, 15 samples
11.
Value/Rank Plot

Platr25 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL2897, 263007 (ID_REF), GDS1729, BC058422
DataSet type:
Expression profiling by array, count, 10 samples
12.
Value/Rank Plot

Platr25 - Sirtuin-1 activator resveratrol effect on adult secondary neurospheres

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5612, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 4 samples
13.
Value/Rank Plot

Platr25 - T helper type 9 cells stimulated with anti-CD3 antibody

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5343, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 6 samples
14.
Value/Rank Plot

Platr25 - High-fat diet effect on obesity-resistant NAG-1 transgenics: colon epithelium

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5264, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 11 samples
15.
Value/Rank Plot

Platr25 - Sirtuin-1 deficiency effect on adult secondary neurospheres

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5611, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 4 samples
16.
Value/Rank Plot

Platr25 - 4T1 breast cancer model: metastatic sub-populations

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5666, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, count, 15 samples
17.
Value/Rank Plot

Platr25 - Hypertension model: kidney

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL9734, 100084454_TGI_at (ID_REF), GDS3675, BC058422
DataSet type:
Expression profiling by array, count, 14 samples
18.
Value/Rank Plot

Platr25 - T helper type 9 cells

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL7202, A_52_P25259 (ID_REF), GDS5291, BC058422, A_52_P25259 (SPOT ID)
DataSet type:
Expression profiling by array, transformed count, 9 samples
19.
Value/Rank Plot

Platr25 - Hypertension model: liver

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL9734, 100084454_TGI_at (ID_REF), GDS3674, BC058422
DataSet type:
Expression profiling by array, count, 15 samples
20.
Value/Rank Plot

Platr25 - MPSS analysis of BLK CL.4 and liver cells

Annotation:
Platr25, pluripotency associated transcript 25
Organism:
Mus musculus
Reporter:
GPL1010, GATCTATGTGTGAAAGCCCA (ID_REF), GDS878, BC058422
DataSet type:
Expression profiling by MPSS, count, 6 samples
Format
Items per page
Sort by

Send to:

Choose Destination

Supplemental Content

Profile data

Download profile data help

Find related data

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center