GEO Profiles Links for Nucleotide (Select 982742418) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 314

<< First< Prev

Page of 16

Next >Last >>

Select item 1159157691.

Cpe - Auditory fear conditioning effect on amygdala: time course

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1228232 (ID_REF), GDS5157, NM_013494, CPE (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115915769

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 881330552.

Cpe - Sox9+ pancreatic cells: developmental time course

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6246, 10578904 (ID_REF), GDS4335, NM_013494, BC010197, U23184, chr8:64592542-64693040 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88133055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 794078553.

Cpe - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6246, 10578904 (ID_REF), GDS4116, NM_013494, BC010197, U23184, chr8:64592542-64693040 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79407855

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 793711554.

Cpe - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6246, 10578904 (ID_REF), GDS4115, NM_013494, BC010197, U23184, chr8:64592542-64693040 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79371155

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756493965.

Cpe - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6481, 2940441 (ID_REF), GDS4002, NM_013494, Cpe (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75649396

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746206696.

Cpe - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1228232 (ID_REF), GDS3974, NM_013494, CPE (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74620669

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 662184787.

Cpe - X chromosome dosage model

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2758940 (ID_REF), GDS3728, NM_013494

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66218478

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643981728.

Cpe - Hypertension model: heart

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL9734, 100084663_TGI_at (ID_REF), GDS3673, NM_013494

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64398172

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625700229.

Cpe - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6333, scl34760.11.1_14-S (ID_REF), GDS3621, NM_013494, Cpe (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62570022

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6159806910.

Cpe - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1228232 (ID_REF), GDS3582, NM_013494, CPE (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61598069

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4905623711.

Cpe - Chronic hypoxia effect on the developing brain

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL5402, scl34760.11.1_14 (ID_REF), GDS3114, NM_013494

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 49056237

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3018095812.

Cpe - High and low weight gainers: hypothalamus

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL2995, 874907 (ID_REF), GDS2320, NM_013494

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30180958

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2851565413.

Cpe - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL2987, 2954 (ID_REF), GDS2227, NM_013494

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28515654

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761693214.

Cpe - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGTAATGCACTTTG (ID_REF), GDS878, NM_013494

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7616932

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747923215.

Cpe - MPSS transcriptome analysis project

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGGTAATGCACTTTG (ID_REF), GDS868, NM_013494

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7479232

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12975635516.

Cpe - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6246, 10578904 (ID_REF), GDS5645, NM_013494, BC010197, U23184, chr8:64592542-64693040 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129756355

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12910865517.

Cpe - Circadian nuclear receptor REV-ERBα deficiency effect on ventral midbrain

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6246, 10578904 (ID_REF), GDS5628, NM_013494, BC010197, U23184, chr8:64592542-64693040 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129108655

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11626286918.

Cpe - Small-molecule inhibition of BRDT effect on testis

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1228232 (ID_REF), GDS5172, NM_013494, CPE (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116262869

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9715777219.

Cpe - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL9734, 100084663_TGI_at (ID_REF), GDS4495, NM_013494

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97157772

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9684455520.

Cpe - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Cpe, carboxypeptidase E

Organism:: Mus musculus

Reporter:: GPL6246, 10578904 (ID_REF), GDS4486, NM_013494, BC010197, U23184, chr8:64592542-64693040 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96844555

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 982742418) (314)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 314

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity