Display Settings:

Format

Send to:

Choose Destination
Pr012373950

STS probe UniSTS:141004 for aconitase 2, mitochondrial (Aco2) and 17 more genes

Synopsis

Field NameValues
NameUniSTS:141004
AliasesAco2; D10Wsu183
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288946; LOC100291880; LOC100294383; ACO2; ACO2; LOC100412501; LOC100444221; ACO2; ACO2; LOC100603083; Aco2; LOC134357; ACO2; ACO2More
UniSTS IDUniSTS:141004

Sequences

>Probe|12373950|PRIMERF Forward PCR primer (outermost) (20b)
GCCTCCAACTTGAACTTCTT
>Probe|12373950|PRIMERR Reverse PCR primer (outermost) (20b)
CAAGAAGGGGGAGAAGAATA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmUniSTS:141004

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center