Display Settings:

Format

Send to:

Choose Destination
Pr012377859

STS probe D19S1071 for actinin alpha 4 (ACTN4) and 2 more genes

Synopsis

Field NameValues
NameD19S1071
AliasesRH35220; SHGC-8810
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesACTN4; ACTN4; ACTN4
UniSTS IDUniSTS:14453

Sequences

>Probe|12377859|PRIMERF Forward PCR primer (outermost) (21b)
AGGAACTTGAGCATCTGTGGA
>Probe|12377859|PRIMERR Reverse PCR primer (outermost) (21b)
TCATGACTGGATGATGCTTGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3191720 cr10000SHGC-8810
Homo sapienslinkageRutgers Map19 cmD19S1071
Homo sapiensradiation hybridNCBI RH19415.1 crSHGC-8810

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID14453
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737124
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center