Display Settings:

Format

Send to:

Choose Destination
Pr012380219

STS probe D17S1275 for profilin 2 (PFN2) and 13 more genes

Synopsis

Field NameValues
NameD17S1275
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPFN2; PFN2; PFN2; LOC100411657; PFN2; PFN2; PFN2; PFN2; Pfn2; PFN2; PFN2; PFN2; RNF13; PFN2
UniSTS IDUniSTS:149820

Sequences

>Probe|12380219|PRIMERF Forward PCR primer (outermost) (22b)
CTCCCCATCTACCTAGCAACTG
>Probe|12380219|PRIMERR Reverse PCR primer (outermost) (22b)
ATGCAAATCATTATTGTGCTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD17S1275

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID149820
Probe Cross-refcontext specific help for: Probe Cross-refGDB:345254
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center