Display Settings:

Format

Send to:

Choose Destination
Pr012386058

STS probe GDB:180362 for coagulation factor XIII A chain (F13A1) and 3 more genes

Synopsis

Field NameValues
NameGDB:180362
AliasSE30
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesF13A1; F13A1; F13A1; F13A1
UniSTS IDUniSTS:155084

Sequences

>Probe|12386058|PRIMERF Forward PCR primer (outermost) (20b)
GAGGTTGCACTCCAGCCTTT
>Probe|12386058|PRIMERR Reverse PCR primer (outermost) (19b)
ATGCCATGCAGATTAGAAA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmGDB:180362

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID155084
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center