Display Settings:

Format

Send to:

Choose Destination
Pr012387323

STS probe GDB:216921 for serpin family B member 2 (SERPINB2) and 2 more genes

Synopsis

Field NameValues
NameGDB:216921
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSERPINB2; SERPINB2; SERPINB2
UniSTS IDUniSTS:156222

Sequences

>Probe|12387323|PRIMERF Forward PCR primer (outermost) (23b)
ACAAAATGGCTGAAGATGAAGTT
>Probe|12387323|PRIMERR Reverse PCR primer (outermost) (21b)
AAGGTCTATGATCTGCAGACC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map18 cmGDB:216921

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156222
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center