Display Settings:

Format

Send to:

Choose Destination
Pr012387877

STS probe GDB:360980 for ciliary neurotrophic factor (CNTF) and 2 more genes

Synopsis

Field NameValues
NameGDB:360980
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCNTF; ZFP91-CNTF; ZFP91
UniSTS IDUniSTS:156721

Sequences

>Probe|12387877|PRIMERF Forward PCR primer (outermost) (19b)
CCTTGGCCAGTGAGATGAG
>Probe|12387877|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGAAGGTTCTCTTGGAGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmGDB:360980

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156721
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center