Display Settings:

Format

Send to:

Choose Destination
Pr031801287

STS probe UniSTS:235740 for tubby bipartite transcription factor (Tub) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:235740
TypeSTS
Application
Source organism
Source sequence
Target genesTub; Ric3
UniSTS IDUniSTS:235740

Sequences

>Probe|31801287|PRIMERF Forward PCR primer (outermost) (20b)
TAGACCCACCTCAAGCAAGG
>Probe|31801287|PRIMERR Reverse PCR primer (outermost) (20b)
AAAGGGTCAGGTGCGTAAGA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID235740
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center