Display Settings:

Format

Send to:

Choose Destination
Pr012480341

STS probe D22S1553 for macrophage migration inhibitory factor (MIF) and 2 more genes

Synopsis

Field NameValues
NameD22S1553
AliasesRH8048; SHGC-13599
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100428978; MIF; MIF
UniSTS IDUniSTS:24485

Sequences

>Probe|12480341|PRIMERF Forward PCR primer (outermost) (18b)
CACCAGAAGGTTGGGGTG
>Probe|12480341|PRIMERR Reverse PCR primer (outermost) (21b)
ACTATTACGACATGAACGCGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map22 cmD22S1553

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24485
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737558; GDB:738677
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center