Display Settings:

Format

Send to:

Choose Destination
Pr012486989

STS probe Z27075 for aconitase 2 (ACO2)

Synopsis

Field NameValues
NameZ27075
AliasesIDVGA-9; IDVGA09
TypeSTS
Application
Source organism
Source sequence
Target organismBos taurus
Target geneACO2
UniSTS IDUniSTS:250833

Sequences

>Probe|12486989|PRIMERF Forward PCR primer (outermost) (21b)
GTCAGGTCTAAACCCAGAGCC
>Probe|12486989|PRIMERR Reverse PCR primer (outermost) (20b)
TCAAAAGGGCAGAGTTCCAC

References

1.

A second-generation linkage map of the bovine genome.

Kappes SM, Keele JW, Stone RT, McGraw RA, Sonstegard TS, Smith TP, Lopez-Corrales NL, Beattie CW.

Genome Res. 1997 Mar;7(3):235-49.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Bos tauruslinkageMARC5118.3 cmZ27075

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID250833
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center