Display Settings:

Format

Send to:

Choose Destination
Pr012528035

STS probe ECD06740 for serpin family B member 2 (SERPINB2) and 1 more gene

Synopsis

Field NameValues
NameECD06740
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSERPINB2; SERPINB2
UniSTS IDUniSTS:287800

Sequences

>Probe|12528035|PRIMERF Forward PCR primer (outermost) (20b)
GGAGTAAGCGTGGACAAAGG
>Probe|12528035|PRIMERR Reverse PCR primer (outermost) (20b)
CCTCCTCCACTGCCTGTATT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map18 cmECD06740

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID287800
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center