Display Settings:

Format

Send to:

Choose Destination
Pr012544520

STS probe ECD21647 for fibroblast growth factor 1 (FGF1) and 9 more genes

Synopsis

Field NameValues
NameECD21647
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100134420; FGF1; LOC100288384; LOC100289931; LOC100430648; LOC100439333; FGF1; FGF1; FGF1; FGF1
UniSTS IDUniSTS:302641

Sequences

>Probe|12544520|PRIMERF Forward PCR primer (outermost) (23b)
TCCCTCTAGTGAAATCACCTCTC
>Probe|12544520|PRIMERR Reverse PCR primer (outermost) (20b)
AAGGATACCGTTTGGAATGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmECD21647

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID302641
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center