Display Settings:

Format

Send to:

Choose Destination
Pr012582236

STS probe REN11804 for serpin family B member 2 (SERPINB2) and 4 more genes

Synopsis

Field NameValues
NameREN11804
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSERPINB10; SERPINB2; SERPINB2; SERPINB2; SERPINB2
UniSTS IDUniSTS:336604

Sequences

>Probe|12582236|PRIMERF Forward PCR primer (outermost) (24b)
AAATAAACCTGCTTCCAAACAACA
>Probe|12582236|PRIMERR Reverse PCR primer (outermost) (24b)
CTGAATTGCTATGTCTTTGCTGCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map18 cmREN11804

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID336604
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center