Display Settings:

Format

Send to:

Choose Destination
Pr012594830

STS probe REN23149 for fibroblast growth factor 1 (FGF1) and 1 more gene

Synopsis

Field NameValues
NameREN23149
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFGF1; FGF1
UniSTS IDUniSTS:347949

Sequences

>Probe|12594830|PRIMERF Forward PCR primer (outermost) (22b)
TGAGGTAGGAGGATTGCTCGAC
>Probe|12594830|PRIMERR Reverse PCR primer (outermost) (24b)
TGTAAGGCAGGATGTTTATCAGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmREN23149

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID347949
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center