Display Settings:

Format

Send to:

Choose Destination
Pr012594989

STS probe REN23291 for fibroblast growth factor 1 (FGF1) and 7 more genes

Synopsis

Field NameValues
NameREN23291
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100134420; LOC100288384; LOC100289931; LOC100430648; FGF1; FGF1; FGF1; FGF1
UniSTS IDUniSTS:348091

Sequences

>Probe|12594989|PRIMERF Forward PCR primer (outermost) (24b)
CCCCAGCTAAGGTAAGTTCCTTCT
>Probe|12594989|PRIMERR Reverse PCR primer (outermost) (25b)
AAATATCTGAGCAATTCCTCTGTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmREN23291

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID348091
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center