Display Settings:

Format

Send to:

Choose Destination
Pr012638598

STS probe REN62559 for cortactin binding protein 2 (CTTNBP2) and 9 more genes

Synopsis

Field NameValues
NameREN62559
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCTTNBP2; CTTNBP2; CTTNBP2; CTTNBP2; CFTR; CTTNBP2; CTTNBP2; LOC536146; CTTNBP2; CTTNBP2
UniSTS IDUniSTS:387359

Sequences

>Probe|12638598|PRIMERF Forward PCR primer (outermost) (27b)
AATACCCCTGAACATCTTGATTAAAAC
>Probe|12638598|PRIMERR Reverse PCR primer (outermost) (24b)
TTTCACACAGAAACCAAGGACAAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmREN62559

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID387359
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center