Display Settings:

Format

Send to:

Choose Destination
Pr012679258

STS probe CFTR for CF transmembrane conductance regulator (CFTR) and 14 more genes

Synopsis

Field NameValues
NameCFTR
AliassWSS852
TypeSTS
Application
Source organism
Source sequence
Target genesCFTR; CFTR; CFTR; CFTR; CFTR; CFTR; Cftr; CFTR; CFTR; CFTR; CFTR; LOC475296; CFTR; CFTRMore
UniSTS IDUniSTS:42397

Sequences

>Probe|12679258|PRIMERF Forward PCR primer (outermost) (21b)
GAAGTCACCAAAGCAGTACAG
>Probe|12679258|PRIMERR Reverse PCR primer (outermost) (20b)
GCTATTCTCATCTGCATTCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3754051
UniSTS IDcontext specific help for: UniSTS ID42397
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center