Display Settings:

Format

Send to:

Choose Destination
Pr012727213

STS probe MARC_36521-36522:1068065051:1 for aconitase 2 (ACO2)

Synopsis

Field NameValues
NameMARC_36521-36522:1068065051:1
TypeSTS
Application
Source organism
Source sequence
Target geneACO2
UniSTS IDUniSTS:467157

Sequences

>Probe|12727213|PRIMERF Forward PCR primer (outermost) (19b)
ACCGGGACAGAGAATCTGC
>Probe|12727213|PRIMERR Reverse PCR primer (outermost) (20b)
GCAGGGTGTGAGGCATAGAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID467157
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center