Display Settings:

Format

Send to:

Choose Destination
Pr012727220

STS probe MARC_36533-36534:1068130515:1 for aconitase 2 (ACO2)

Synopsis

Field NameValues
NameMARC_36533-36534:1068130515:1
TypeSTS
Application
Source organism
Source sequence
Target geneACO2
UniSTS IDUniSTS:467163

Sequences

>Probe|12727220|PRIMERF Forward PCR primer (outermost) (20b)
AATGCCCATGAAGGAATGTC
>Probe|12727220|PRIMERR Reverse PCR primer (outermost) (18b)
GCTGGTGGGACTCACGTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID467163
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center