Display Settings:

Format

Send to:

Choose Destination
Pr012751662

STS probe ADH1B for alcohol dehydrogenase-E-isoenzyme (LOC100034242)

Synopsis

Field NameValues
NameADH1B
TypeSTS
Application
Source organism
Source sequence
Target geneLOC100034242
UniSTS IDUniSTS:503452

Sequences

>Probe|12751662|PRIMERF Forward PCR primer (outermost) (21b)
GGAGTGGGCCTGTCTGTTATC
>Probe|12751662|PRIMERR Reverse PCR primer (outermost) (21b)
GAAAAATCCACACCTCCATTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID503452
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center