Display Settings:

Format

Send to:

Choose Destination
Pr012783607

STS probe Shc1 for src homology 2 domain-containing transforming protein C1 (Shc1) and 5 more genes

Synopsis

Field NameValues
NameShc1
TypeSTS
Application
Source organism
Source sequence
Target genesSHC1; SHC1; Shc1; Shc1; SHC1; Shc1
UniSTS IDUniSTS:532499

Sequences

>Probe|12783607|PRIMERF Forward PCR primer (outermost) (20b)
ACCTGGGGTTTCCTACTTGG
>Probe|12783607|PRIMERR Reverse PCR primer (outermost) (20b)
GATTGGCATTCCAGCAAACT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center