Display Settings:

Format

Send to:

Choose Destination
Pr012804802

STS probe A008Q24 for actinin alpha 4 (ACTN4) and 1 more gene

Synopsis

Field NameValues
NameA008Q24
AliasRH26630
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesACTN4; ACTN4
UniSTS IDUniSTS:5922

Sequences

>Probe|12804802|PRIMERF Forward PCR primer (outermost) (22b)
AATCTGTGATCTTGACCATGTA
>Probe|12804802|PRIMERR Reverse PCR primer (outermost) (19b)
ATCGAGGGGACTCAATTAT

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419223.6 cr3000A008Q24
Homo sapienslinkageRutgers Map19 cmA008Q24

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID5922
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center