Display Settings:

Format

Send to:

Choose Destination
Pr012836956

STS probe D11S4596 for ciliary neurotrophic factor (CNTF) and 8 more genes

Synopsis

Field NameValues
NameD11S4596
AliasesRH7880; SHGC-11237
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesZFP91; ZFP91; CNTF; CNTF; CNTF; CNTF; ZFP91-CNTF; ZFP91; CNTF
UniSTS IDUniSTS:8841

Sequences

>Probe|12836956|PRIMERF Forward PCR primer (outermost) (20b)
ACCAGCAGGTGCATTTTACC
>Probe|12836956|PRIMERR Reverse PCR primer (outermost) (20b)
GGGATCCCAGTCTGATGAGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3112477 cr10000SHGC-11237
Homo sapiensradiation hybridGeneMap99-G3112477 cr10000SHGC-11237
Homo sapienslinkageRutgers Map11 cmD11S4596
Homo sapiensradiation hybridNCBI RH11502.5 crSHGC-11237

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID8841
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740288; GDB:741722
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center