Display Settings:

Format

Send to:

Choose Destination
Pr012840576

STS probe RH80063 for galectin 7 (LGALS7) and 6 more genes

Synopsis

Field NameValues
NameRH80063
TypeSTS
Application
Source organism
Source sequence
Target genesLGALS7B; LGALS7; LGALS7B; LGALS7; LGALS7; LGALS7B; LOC694781
UniSTS IDUniSTS:91678

Sequences

>Probe|12840576|PRIMERF Forward PCR primer (outermost) (20b)
TGCTCAGAAGATCCTCACGG
>Probe|12840576|PRIMERR Reverse PCR primer (outermost) (20b)
GGTGGTCTTCAACAGCAAGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID91678
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center