Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs34165476

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr22:16369271 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
T>C
Variation Type
SNV Single Nucleotide Variation
Frequency
T=0.0749 (168/2242, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
None
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20230706150541
Population Group Sample Size Ref Allele Alt Allele
Total Global 2242 T=0.0749 C=0.9251
European Sub 2002 T=0.0340 C=0.9660
African Sub 48 T=0.33 C=0.67
African Others Sub 0 T=0 C=0
African American Sub 48 T=0.33 C=0.67
Asian Sub 0 T=0 C=0
East Asian Sub 0 T=0 C=0
Other Asian Sub 0 T=0 C=0
Latin American 1 Sub 0 T=0 C=0
Latin American 2 Sub 0 T=0 C=0
South Asian Sub 0 T=0 C=0
Other Sub 192 T=0.438 C=0.562


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
Allele Frequency Aggregator Total Global 2242 T=0.0749 C=0.9251
Allele Frequency Aggregator European Sub 2002 T=0.0340 C=0.9660
Allele Frequency Aggregator Other Sub 192 T=0.438 C=0.562
Allele Frequency Aggregator African Sub 48 T=0.33 C=0.67
Allele Frequency Aggregator Latin American 1 Sub 0 T=0 C=0
Allele Frequency Aggregator Latin American 2 Sub 0 T=0 C=0
Allele Frequency Aggregator South Asian Sub 0 T=0 C=0
Allele Frequency Aggregator Asian Sub 0 T=0 C=0
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 22 NC_000022.11:g.16369271T>C
GRCh37.p13 chr 22 NC_000022.10:g.16849933C>T
GRCh38.p14 chr 22 fix patch HG1485_PATCH NW_021160024.1:g.341277T>C
GRCh37.p13 chr 22 fix patch HG1488_PATCH NW_004070875.1:g.38633C>T
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement T= C
GRCh38.p14 chr 22 NC_000022.11:g.16369271= NC_000022.11:g.16369271T>C
GRCh37.p13 chr 22 NC_000022.10:g.16849933C>T NC_000022.10:g.16849933=
GRCh38.p14 chr 22 fix patch HG1485_PATCH NW_021160024.1:g.341277= NW_021160024.1:g.341277T>C
GRCh37.p13 chr 22 fix patch HG1488_PATCH NW_004070875.1:g.38633C>T NW_004070875.1:g.38633=
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

34 SubSNP, 1 Frequency submissions
No Submitter Submission ID Date (Build)
1 HGSV ss81227910 Dec 15, 2007 (130)
2 ILLUMINA-UK ss117354594 Dec 01, 2009 (142)
3 BCM-HGSC-SUB ss208830284 Jul 04, 2010 (142)
4 BL ss255820267 May 09, 2011 (134)
5 GMI ss283571885 May 04, 2012 (137)
6 GMI ss287544455 Apr 25, 2013 (138)
7 PJP ss292731382 May 09, 2011 (134)
8 SSMP ss662461954 Apr 25, 2013 (138)
9 EVA-GONL ss995198312 Aug 21, 2014 (142)
10 1000GENOMES ss1366591233 Aug 21, 2014 (142)
11 DDI ss1429210302 Apr 09, 2015 (144)
12 EVA_UK10K_ALSPAC ss1639714599 Apr 09, 2015 (144)
13 EVA_UK10K_TWINSUK ss1682708632 Apr 09, 2015 (144)
14 WEILL_CORNELL_DGM ss1938755206 Feb 17, 2016 (147)
15 JJLAB ss2030152101 Sep 28, 2016 (149)
16 USC_VALOUEV ss2158757959 Oct 12, 2018 (152)
17 GRF ss2704492824 Oct 12, 2018 (152)
18 GNOMAD ss2972689225 Oct 12, 2018 (152)
19 GNOMAD ss2972689226 Oct 12, 2018 (152)
20 SWEGEN ss3019030586 Oct 12, 2018 (152)
21 CSHL ss3352759906 Oct 12, 2018 (152)
22 ACPOP ss3743801553 Jul 13, 2019 (153)
23 PACBIO ss3788785035 Jul 13, 2019 (153)
24 PACBIO ss3793657348 Jul 13, 2019 (153)
25 PACBIO ss3798543680 Jul 13, 2019 (153)
26 EVA ss3835915129 Apr 27, 2020 (154)
27 EVA ss3841585773 Apr 27, 2020 (154)
28 SGDP_PRJ ss3890192276 Apr 27, 2020 (154)
29 KRGDB ss3940555390 Apr 27, 2020 (154)
30 TOMMO_GENOMICS ss5231914758 Apr 26, 2021 (155)
31 EVA ss5440375851 Oct 13, 2022 (156)
32 SANFORD_IMAGENETICS ss5664180124 Oct 13, 2022 (156)
33 EVA ss5821863781 Oct 13, 2022 (156)
34 EVA ss5959064318 Oct 13, 2022 (156)
35 ALFA NC_000022.11 - 16369271 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Associated ID History Updated (Build)
rs59903517 May 25, 2008 (130)
rs79515084 Aug 21, 2014 (142)
rs111820624 Sep 17, 2011 (135)
Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss81227910 NC_000022.8:15224486:C:C NC_000022.11:16369270:T:C (self)
ss117354594, ss208830284, ss255820267, ss283571885, ss287544455, ss292731382 NC_000022.9:15229932:C:C NC_000022.11:16369270:T:C (self)
ss2972689225 NC_000022.10:16849920:GAACAGAATCTT…

NC_000022.10:16849920:GAACAGAATCTTCGTTGAATAGACTC:GAACAGAATCTTCGTTGAATAGACTC

NC_000022.11:16369270:T:C (self)
ss662461954, ss995198312, ss1366591233, ss1429210302, ss1639714599, ss1682708632, ss1938755206, ss2030152101, ss2158757959, ss2704492824, ss2972689226, ss3019030586, ss3352759906, ss3743801553, ss3788785035, ss3793657348, ss3798543680, ss3835915129, ss3841585773, ss3890192276, ss3940555390, ss5231914758, ss5440375851, ss5664180124, ss5821863781, ss5959064318 NC_000022.10:16849932:C:C NC_000022.11:16369270:T:C (self)
12467105296 NC_000022.11:16369270:T:C NC_000022.11:16369270:T:C (self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs34165476

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post761+d5e8e07