Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs372284318

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr1:84031-84033 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delAA / dupA / dupAA / ins(CAAAGAA…

delAA / dupA / dupAA / ins(CAAAGAAA)2G(A)4 / insC(AAAG)2(A)4

Variation Type
Indel Insertion and Deletion
Frequency
dupA=0.02441 (665/27244, 14KJPN)
dupA=0.03641 (604/16588, 8.3KJPN)
delAA=0.00000 (0/10650, ALFA) (+ 8 more)
dupA=0.00000 (0/10650, ALFA)
dupAA=0.00000 (0/10650, ALFA)
insC(AAAG)2(A)4=0.00000 (0/10650, ALFA)
dupA=0.0335 (129/3854, ALSPAC)
dupA=0.0297 (110/3708, TWINSUK)
dupA=0.0534 (97/1816, Korea1K)
dupA=0.037 (20/536, NorthernSweden)
dupA=0.05 (2/40, GENOME_DK)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
None
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20230706150541
Population Group Sample Size Ref Allele Alt Allele
Total Global 10650 AAA=1.00000 A=0.00000, AAAA=0.00000, AAAAA=0.00000, AAACAAAGAAAGAAAA=0.00000
European Sub 7316 AAA=1.0000 A=0.0000, AAAA=0.0000, AAAAA=0.0000, AAACAAAGAAAGAAAA=0.0000
African Sub 2240 AAA=1.0000 A=0.0000, AAAA=0.0000, AAAAA=0.0000, AAACAAAGAAAGAAAA=0.0000
African Others Sub 88 AAA=1.00 A=0.00, AAAA=0.00, AAAAA=0.00, AAACAAAGAAAGAAAA=0.00
African American Sub 2152 AAA=1.0000 A=0.0000, AAAA=0.0000, AAAAA=0.0000, AAACAAAGAAAGAAAA=0.0000
Asian Sub 56 AAA=1.00 A=0.00, AAAA=0.00, AAAAA=0.00, AAACAAAGAAAGAAAA=0.00
East Asian Sub 40 AAA=1.00 A=0.00, AAAA=0.00, AAAAA=0.00, AAACAAAGAAAGAAAA=0.00
Other Asian Sub 16 AAA=1.00 A=0.00, AAAA=0.00, AAAAA=0.00, AAACAAAGAAAGAAAA=0.00
Latin American 1 Sub 130 AAA=1.000 A=0.000, AAAA=0.000, AAAAA=0.000, AAACAAAGAAAGAAAA=0.000
Latin American 2 Sub 420 AAA=1.000 A=0.000, AAAA=0.000, AAAAA=0.000, AAACAAAGAAAGAAAA=0.000
South Asian Sub 94 AAA=1.00 A=0.00, AAAA=0.00, AAAAA=0.00, AAACAAAGAAAGAAAA=0.00
Other Sub 394 AAA=1.000 A=0.000, AAAA=0.000, AAAAA=0.000, AAACAAAGAAAGAAAA=0.000


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
14KJPN JAPANESE Study-wide 27244 -

No frequency provided

dupA=0.02441
8.3KJPN JAPANESE Study-wide 16588 -

No frequency provided

dupA=0.03641
Allele Frequency Aggregator Total Global 10650 AAA=1.00000 delAA=0.00000, dupA=0.00000, dupAA=0.00000, insC(AAAG)2(A)4=0.00000
Allele Frequency Aggregator European Sub 7316 AAA=1.0000 delAA=0.0000, dupA=0.0000, dupAA=0.0000, insC(AAAG)2(A)4=0.0000
Allele Frequency Aggregator African Sub 2240 AAA=1.0000 delAA=0.0000, dupA=0.0000, dupAA=0.0000, insC(AAAG)2(A)4=0.0000
Allele Frequency Aggregator Latin American 2 Sub 420 AAA=1.000 delAA=0.000, dupA=0.000, dupAA=0.000, insC(AAAG)2(A)4=0.000
Allele Frequency Aggregator Other Sub 394 AAA=1.000 delAA=0.000, dupA=0.000, dupAA=0.000, insC(AAAG)2(A)4=0.000
Allele Frequency Aggregator Latin American 1 Sub 130 AAA=1.000 delAA=0.000, dupA=0.000, dupAA=0.000, insC(AAAG)2(A)4=0.000
Allele Frequency Aggregator South Asian Sub 94 AAA=1.00 delAA=0.00, dupA=0.00, dupAA=0.00, insC(AAAG)2(A)4=0.00
Allele Frequency Aggregator Asian Sub 56 AAA=1.00 delAA=0.00, dupA=0.00, dupAA=0.00, insC(AAAG)2(A)4=0.00
The Avon Longitudinal Study of Parents and Children PARENT AND CHILD COHORT Study-wide 3854 -

No frequency provided

dupA=0.0335
UK 10K study - Twins TWIN COHORT Study-wide 3708 -

No frequency provided

dupA=0.0297
Korean Genome Project KOREAN Study-wide 1816 -

No frequency provided

dupA=0.0534
Northern Sweden ACPOP Study-wide 536 -

No frequency provided

dupA=0.037
The Danish reference pan genome Danish Study-wide 40 -

No frequency provided

dupA=0.05
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 1 NC_000001.11:g.84032_84033del
GRCh38.p14 chr 1 NC_000001.11:g.84033dup
GRCh38.p14 chr 1 NC_000001.11:g.84032_84033dup
GRCh38.p14 chr 1 NC_000001.11:g.84031_84033AAACAAAG[2]AAAGAAAA[1]
GRCh38.p14 chr 1 NC_000001.11:g.84033_84034insCAAAGAAAGAAAA
GRCh37.p13 chr 1 NC_000001.10:g.84032_84033del
GRCh37.p13 chr 1 NC_000001.10:g.84033dup
GRCh37.p13 chr 1 NC_000001.10:g.84032_84033dup
GRCh37.p13 chr 1 NC_000001.10:g.84031_84033AAACAAAG[2]AAAGAAAA[1]
GRCh37.p13 chr 1 NC_000001.10:g.84033_84034insCAAAGAAAGAAAA
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement AAA= delAA dupA dupAA ins(CAAAGAAA)2G(A)4 insC(AAAG)2(A)4
GRCh38.p14 chr 1 NC_000001.11:g.84031_84033= NC_000001.11:g.84032_84033del NC_000001.11:g.84033dup NC_000001.11:g.84032_84033dup NC_000001.11:g.84031_84033AAACAAAG[2]AAAGAAAA[1] NC_000001.11:g.84033_84034insCAAAGAAAGAAAA
GRCh37.p13 chr 1 NC_000001.10:g.84031_84033= NC_000001.10:g.84032_84033del NC_000001.10:g.84033dup NC_000001.10:g.84032_84033dup NC_000001.10:g.84031_84033AAACAAAG[2]AAAGAAAA[1] NC_000001.10:g.84033_84034insCAAAGAAAGAAAA
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

17 SubSNP, 11 Frequency submissions
No Submitter Submission ID Date (Build)
1 LUNTER ss550899111 Apr 25, 2013 (138)
2 SSMP ss663209799 Apr 01, 2015 (144)
3 BILGI_BIOE ss666079957 Apr 25, 2013 (138)
4 EVA_GENOME_DK ss1573867087 Apr 01, 2015 (144)
5 EVA_UK10K_ALSPAC ss1700140381 Apr 01, 2015 (144)
6 EVA_UK10K_TWINSUK ss1700153070 Apr 01, 2015 (144)
7 PADH-LAB_SPU ss1751134631 Sep 08, 2015 (146)
8 EVA_DECODE ss3685990682 Jul 12, 2019 (153)
9 EVA_DECODE ss3685990683 Jul 12, 2019 (153)
10 ACPOP ss3726715274 Jul 12, 2019 (153)
11 KOGIC ss3943623152 Apr 25, 2020 (154)
12 GNOMAD ss3986894098 Apr 25, 2021 (155)
13 GNOMAD ss3986894099 Apr 25, 2021 (155)
14 GNOMAD ss3986894100 Apr 25, 2021 (155)
15 TOMMO_GENOMICS ss5142034360 Apr 25, 2021 (155)
16 HUGCELL_USP ss5442111047 Oct 12, 2022 (156)
17 TOMMO_GENOMICS ss5666167184 Oct 12, 2022 (156)
18 The Avon Longitudinal Study of Parents and Children NC_000001.10 - 84031 Oct 11, 2018 (152)
19 The Danish reference pan genome NC_000001.10 - 84031 Apr 25, 2020 (154)
20 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 9277 (NC_000001.11:84030::A 3387/89146)
Row 9278 (NC_000001.11:84030::AAACAAAGAAACAAAGAAAGA 10/90088)
Row 9279 (NC_000001.11:84030::AAACAAAGAAAGA 118/90006)

- Apr 25, 2021 (155)
21 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 9277 (NC_000001.11:84030::A 3387/89146)
Row 9278 (NC_000001.11:84030::AAACAAAGAAACAAAGAAAGA 10/90088)
Row 9279 (NC_000001.11:84030::AAACAAAGAAAGA 118/90006)

- Apr 25, 2021 (155)
22 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 9277 (NC_000001.11:84030::A 3387/89146)
Row 9278 (NC_000001.11:84030::AAACAAAGAAACAAAGAAAGA 10/90088)
Row 9279 (NC_000001.11:84030::AAACAAAGAAAGA 118/90006)

- Apr 25, 2021 (155)
23 Korean Genome Project NC_000001.11 - 84031 Apr 25, 2020 (154)
24 Northern Sweden NC_000001.10 - 84031 Jul 12, 2019 (153)
25 8.3KJPN NC_000001.10 - 84031 Apr 25, 2021 (155)
26 14KJPN NC_000001.11 - 84031 Oct 12, 2022 (156)
27 UK 10K study - Twins NC_000001.10 - 84031 Oct 11, 2018 (152)
28 ALFA NC_000001.11 - 84031 Apr 25, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Associated ID History Updated (Build)
rs372745296 May 15, 2013 (138)
Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss3685990683 NC_000001.11:84030:AA: NC_000001.11:84030:AAA:A (self)
11191381483 NC_000001.11:84030:AAA:A NC_000001.11:84030:AAA:A (self)
ss550899111 NC_000001.9:73893::A NC_000001.11:84030:AAA:AAAA (self)
22, 120146, 139, 3667, 22, ss663209799, ss666079957, ss1573867087, ss1700140381, ss1700153070, ss1751134631, ss3726715274, ss5142034360 NC_000001.10:84030::A NC_000001.11:84030:AAA:AAAA (self)
1153, 4288, ss3943623152, ss3986894098, ss5442111047, ss5666167184 NC_000001.11:84030::A NC_000001.11:84030:AAA:AAAA (self)
11191381483 NC_000001.11:84030:AAA:AAAA NC_000001.11:84030:AAA:AAAA (self)
ss3685990682 NC_000001.11:84032::A NC_000001.11:84030:AAA:AAAA (self)
11191381483 NC_000001.11:84030:AAA:AAAAA NC_000001.11:84030:AAA:AAAAA (self)
ss3986894099 NC_000001.11:84030::AAACAAAGAAACAA…

NC_000001.11:84030::AAACAAAGAAACAAAGAAAGA

NC_000001.11:84030:AAA:AAACAAAGAAA…

NC_000001.11:84030:AAA:AAACAAAGAAACAAAGAAAGAAAA

(self)
ss3986894100 NC_000001.11:84030::AAACAAAGAAAGA NC_000001.11:84030:AAA:AAACAAAGAAA…

NC_000001.11:84030:AAA:AAACAAAGAAAGAAAA

(self)
11191381483 NC_000001.11:84030:AAA:AAACAAAGAAA…

NC_000001.11:84030:AAA:AAACAAAGAAAGAAAA

NC_000001.11:84030:AAA:AAACAAAGAAA…

NC_000001.11:84030:AAA:AAACAAAGAAAGAAAA

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs372284318

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post761+d5e8e07