Submitter | Handle | EVA_GENOME_DK | Submitter SNP ID | EVA_GENOME_DK_gatk_indels_rs376342519 | RefSNP(rs#) | rs376342519 | Submitted Batch ID | gatk | Submitted Date | Feb 19, 2015 | Publication Cited | N.D. | First entry to dbSNP | Feb 19 2015 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| | Allele | Observed Allele | CGCCGTTGCAAAGGCGCGCCG/- | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| | Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss1573866481|allelePos=26|len=51|taxid=9606|alleles='CGCCGTTGCAAAGGCGCGCCG/-'|mol=Genomic GTCTGTGCTG AGGAGAACGC AACTC
N
CGCCGGCGCA GGCGCAGAGA GGCGC
There is no frequency submission for ss1573866481.
No sufficient data to compute Hardy-weinberg probability for ss1573866481.
There is no individual genotype data for ss1573866481.
|