dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP history

This subsnp was deleted.

Delete record
Delete Date:Jun 23, 2021
Delete Reason:Update by submitter
Original HandleTOPMED
Orignial Submitter snp id 10_157397_GAAGAAGAAAAAGGAAAATA/G

The same handle and local_snp_id was not resubmitted.