NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss325997501           
Submitter
Handle1000GENOMES
Submitter SNP IDJPTCHB_chr1_811467_indel
RefSNP(rs#)rs149920886
Submitted Batch IDJPTCHB_low_coverage_pilot_indel
Submitted DateMar 11, 2011
Publication Cited20980555 20980557 20981092
First entry to dbSNPMar 11 2011 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodLOW_COVERAGE_PILOT_INDELS
Ascertainment Samplesize120
Populationpilot_1_CHB+JPT_low_coverage_panel
Allele
Observed Allele-/GCCCTTTGGCAGAGCAGGTGTGCTGTGCTG
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassDIV
CpG CodeN.D.
Validation
Validation StatusNot Validated
HWE Goodness of Fitnot applicable
Variation
Frequency SubmissionN.D.
Genotype SummaryN.D.
Genotype SubmissionN.D.
HaplotypeN.D.

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss325997501|allelePos=51|len=101|taxid=9606|alleles='-/GCCCTTTGGCAGAGCAGGTGTGCTGTGCTG'|mol=Genomic
 CCCAGTCAGG GGAAACAAGA TCAGGAACTG CTTAAAGAAG CAGTCTGGCT
 N
 GCCCTTTGGC AGAGCAGGTG TGCTGTGCTG TGCTGATCCC CGGGAGTCTC

  Submitted Frequency for ss325997501 back to top
There is no frequency submission for ss325997501.


  dbSNP summary of Genotypes for ss325997501 back to top
No sufficient data to compute Hardy-weinberg probability for ss325997501.


  Submitted individual genotype for ss325997501 back to top
There is no individual genotype data for ss325997501.