Submitter | Handle | EGCUT_WGS | Submitter SNP ID | VAR12 | RefSNP(rs#) | clustering in process | Submitted Batch ID | E22 | Submitted Date | Aug 28, 2018 | Publication Cited | [1] Genetic variation in the Estonian population: pharmacogenomics study of adverse drug effects using electronic health records | First entry to dbSNP | Aug 28 2018 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| Assay | Species | Homo sapiens | Molecular Type | Genomic | Method | PCR_FREE_WGS | Ascertainment Samplesize | 2240 | Population | EGCUT_WGS |
| Allele | Observed Allele | -/TGCTCTGTCACCCAGGCTGGAG | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss3654261764|allelePos=26|len=51|taxid=9606|alleles='-/TGCTCTGTCACCCAGGCTGGAG'|mol=Genomic TTTTTTTTTT TTTTAGACGG AGTCT
N
TGCTCTGTCA CCCAGGCTGG AGTGC
There is no frequency submission for ss3654261764.
No sufficient data to compute Hardy-weinberg probability for ss3654261764.
There is no individual genotype data for ss3654261764.
|