Submitter | Handle | 1000G_HIGH_COVERAGE | Submitter SNP ID | 1:10403:A:ACCCTAACCC | RefSNP(rs#) | clustering in process | Submitted Batch ID | 30x_grch38 | Submitted Date | Jul 01, 2021 | Publication Cited | N.D. | First entry to dbSNP | Jul 1 2021 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| Assay | Species | Homo sapiens | Molecular Type | Genomic | Method | SEQ | Ascertainment Samplesize | 6404 | Population | N.D. |
| Allele | Observed Allele | -/CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss5240854479|allelePos=26|len=51|taxid=9606|alleles='-/CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC'|mol=Genomic CCTAACCCTA ACCCCTAACC CCTAA
N
CCCTAACCCT AACCCTAACC CTAAC
There is no frequency submission for ss5240854479.
No sufficient data to compute Hardy-weinberg probability for ss5240854479.
There is no individual genotype data for ss5240854479.
|