NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586188           
Submitter
HandleSNP500CANCER
Submitter SNP IDADH1B-01
RefSNP(rs#)rs2066702
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginT:Germline C:Germline
SNP ClassSNV
CpG Codec/t_g
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TCACTAAGACACCTCAGATGC, Temp: 55.46, GC Content:47.62, Product Size: 244 Primer R: CCCCCATGTGTAATTTATTG, Temp: 55.32, GC Content:40

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586188|allelePos=210|len=422|taxid=9606|alleles='C/T'|mol=Genomic
 TTAAGATTGg agaaaaaaag aaaagaaaag aaaaCCAAAA AAGATGAACT TCCTTTTTCT
 TGAACCAAAT GTATGGGGAT GGAAATAGGG TAGCTGGGAT CACAGACAGA TTTTCACTAA
 GACACCTCAG ATGCTCCTTG GACTCTCACA ACAAGCATGT GGGTTGTCTA AATGTTAACA
 CAATGTCTCT TCTTTCCTAT TGCAGTATC
 Y
 GTACCGTCCT GACGTTTTGA GGCAATAGAG ATGCCTTCCC CTGTAGCAGT CTTCAGCCTC
 CTCTACCCTA CRAGATCTGG AGCAACAGCT AGGAAATATC ATTAATTCAG CTCTTCAGAG
 ATGTTATCAA TAAATTACAC ATGGGGGCTT TCCAAAGAAA TGGAAATTGA TGGGAAATTA
 TTTTTCAGGA AAATTTAAAA TTCAAGTGAG AA

  Submitted Frequency for ss5586188 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
T/T=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.83300000
T=0.16700000
0.278 +/-0.101C/C=0.70800000
C/T=0.25000000
T/T=0.04200000
0.25008272003SNP500CANCER
CAUC1
MULTI-NATIONAL
60C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
T/T=0.00000000
08272003SNP500CANCER
P1
MULTI-NATIONAL
202C=0.95999998
T=0.04000000
0.077 +/-0.036C/C=0.93099999
C/T=0.05900000
T/T=0.01000000
0.05908272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=1.00000000
T=0.00000000
C/C=1.00000000
C/T=0.00000000
T/T=0.00000000
08272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586188 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586188.


  Submitted individual genotype for ss5586188 back to top
There is no individual genotype data for ss5586188.