NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586191           
Submitter
HandleSNP500CANCER
Submitter SNP IDADH1B-04
RefSNP(rs#)rs1041969
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/C
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusNot Validated
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 6
Genotype Summarypopulation count: 11
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TGAATAACCTTGGGGATAAAC, Temp: 47.9, GC Content:38.1, Product Size: 397 Primer R: CACTTTCGTCTCTCATTGC, Temp: 45.1, GC Content:47.37

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586191|allelePos=146|len=336|taxid=9606|alleles='A/C'|mol=Genomic
 TACATTTTAG AAACACAATT TCAGGAATTT GGGTATGTTA AATTCATCTA GTTACAATCT
 TTTCTGAATC TGAACAGCTT CTCTTTATTC TGTAGATGGT GGCTGTAGGA ATCTGTCRCA
 CAGATGACCA CGTGGTTAGT GGCAA
 M
 CTGGTGWCCC CCCTTCCTGT GATTTTAGGC CATGAGGCAG CCGGCATCGT GGAGAGTGTT
 GGAGAAGGGG TGACTACAGT CAAACCAGGT ACAGGATTCA CACTCAGGGA ACACGTGTGG
 TTCACCATCC AGGATTTCCC AGCCTGGATA AGGAAACCAA GGCAATGAGA GACGAAAGTG
 CTTGCACAAG

  Submitted Frequency for ss5586191 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
CEPH
MULTI-NATIONAL
184C=1.00000000
A=0.00000000
1_2004SEQUENOM
PAC1
MULTI-NATIONAL
46C=1.00000000
C/C=1.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=1.00000000
C/C=1.00000000
08272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=1.00000000
C/C=1.00000000
08272003SNP500CANCER
P1
MULTI-NATIONAL
202C=1.00000000
C/C=1.00000000
08272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=1.00000000
C/C=1.00000000
08272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586191 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586191.


  Submitted individual genotype for ss5586191 back to top
There is no individual genotype data for ss5586191.