NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586192           
Submitter
HandleSNP500CANCER
Submitter SNP IDADH1B-05
RefSNP(rs#)rs17033
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec_g/a
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 6
Genotype Summarypopulation count: 19
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TCACTAAGACACCTCAGATGC, Temp: 55.46, GC Content:47.62, Product Size: 244 Primer R: CCCCCATGTGTAATTTATTG, Temp: 55.32, GC Content:40
Platform: TaqMan Forward primer: ACCCTACAAGATCTG, Amount: 900 nM Reverse primer: CCTACGAGATCTGG, Amount: 900 nM Probe 1: CCTTCCCCTGTAGCAGTCTTCA, Amount: 200 nM Probe 2: TGAATTAATGATATTTCCTAGCTGTTGCT, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586192|allelePos=226|len=576|taxid=9606|alleles='A/G'|mol=Genomic
 TTCTTGAACC AAATGTATGG GGATGGAAAT AGGGTAGCTG GGATCACAGA CAGATTTTCA
 CTAAGACACC TCAGATGCTC CTTGGACTCT CACAACAAGC ATGTGGGTTG TCTAAATGTT
 AACACAATGT CTCTTCTTTC CTATTGCAGT ATCYGTACCG TCCTGACGTT TTGAGGCAAT
 AGAGATGCCT TCCCCTGTAG CAGTCTTCAG CCTCCTCTAC CCTAC
 R
 AGATCTGGAG CAACAGCTAG GAAATATCAT TAATTCAGCT CTTCAGAGAT GTTATCAATA
 AATTACACAT GGGGGCTTTC CAAAGAAATG GAAATTGATG GGAAATTATT TTTCAGGAAA
 ATTTAAAATT CAAGTGAGAA GTAAATAAAG TGTTGAACAT CAGCTGGGGA ATTGAAGCCA
 ACAAACCTTC CTTCTTAACC ATTCTACTGT GTCACCTTTG CCATTGAGGA AAAATATTCC
 TGTGACTTCT TGCATTTTTG GTATCTTCAT AATCTTTAGT CATCGAATCC CAGTGGAGGG
 GACCCTTTTA CTTGCCCTGA ACATACACAT GCTGGGCCAT TGTGATTGAA

  Submitted Frequency for ss5586192 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
CEPH
MULTI-NATIONAL
184A=0.92000002
G=0.08000000
0.147 +/-0.0481_2004SEQUENOM
PAC1
MULTI-NATIONAL
48A=0.89600003
G=0.10400000
0.186 +/-0.099A/A=0.79200000
A/G=0.20800000
G/G=0.00000000
0.20808272003SNP500CANCER
AFR1
MULTI-NATIONAL
48A=0.91700000
G=0.08300000
0.152 +/-0.094A/A=0.83300000
A/G=0.16700000
G/G=0.00000000
0.16708272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62A=0.95200002
G=0.04800000
0.091 +/-0.069A/A=0.90300000
A/G=0.09700000
G/G=0.00000000
0.09708272003SNP500CANCER
P1
MULTI-NATIONAL
204A=0.90200001
G=0.09800000
0.177 +/-0.047A/A=0.82400000
A/G=0.15700001
G/G=0.01900000
0.15708272003SNP500CANCER
HISP1
MULTI-NATIONAL
46A=0.82599998
G=0.17399999
0.287 +/-0.103A/A=0.73900002
A/G=0.17399999
G/G=0.08700000
0.17408272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586192 back to top

Population ID
 -Class
Total
Sample
(2N)
Founder
(2N)
Major
Allele
Freq.
Minor
Allele
Freq.
Genotype
Freq.
HWE Goodness of FitData
Source
HapMap-CEU226226A=0.89823008
G=0.10176991A/A=0.80530971
A/G=0.18584071
G/G=0.00884956
Pr(chiSq=0.031,df=1)
=1.000
Genotype
Freq.
HapMap-HCB
EAST ASIA
8686A=0.87209302
G=0.12790698A/A=0.76744187
A/G=0.20930232
G/G=0.02325581
Pr(chiSq=0.164,df=1)
=0.752
Genotype
Freq.
HapMap-JPT172172A=0.88953489
G=0.11046512A/A=0.77906978
A/G=0.22093023
Pr(chiSq=0.277,df=1)
=0.655
Genotype
Freq.
HapMap-YRI226226A=0.92920351
G=0.07079646A/A=0.85840708
A/G=0.14159292
Pr(chiSq=0.090,df=1)
=1.000
Genotype
Freq.
HAPMAP-ASW9898A=0.89795917
G=0.10204082A/A=0.81632656
A/G=0.16326530
G/G=0.02040816
Pr(chiSq=0.583,df=1)
=0.479
Genotype
Freq.
HAPMAP-CHB8282A=0.87804878
G=0.12195122A/A=0.78048778
A/G=0.19512194
G/G=0.02439024
Pr(chiSq=0.324,df=1)
=0.584
Genotype
Freq.
HAPMAP-CHD170170A=0.94117647
G=0.05882353A/A=0.88235295
A/G=0.11764706
Pr(chiSq=0.038,df=1)
=1.000
Genotype
Freq.
HAPMAP-GIH176176A=0.97727275
G=0.02272727A/A=0.95454544
A/G=0.04545455
Pr(chiSq=0.002,df=1)
=1.000
Genotype
Freq.
HAPMAP-LWK180180A=0.90555555
G=0.09444445A/A=0.82222223
A/G=0.16666667
G/G=0.01111111
Pr(chiSq=0.059,df=1)
=1.000
Genotype
Freq.
HAPMAP-MEX100100A=0.63000000
G=0.37000000A/A=0.44000000
A/G=0.38000000
G/G=0.18000001
Pr(chiSq=1.709,df=1)
=0.200
Genotype
Freq.
HAPMAP-MKK282282A=0.92198581
G=0.07801419A/A=0.84397161
A/G=0.15602838
Pr(chiSq=0.151,df=1)
=0.752
Genotype
Freq.
HAPMAP-TSI172172A=0.92441863
G=0.07558139A/A=0.84883720
A/G=0.15116279
Pr(chiSq=0.084,df=1)
=1.000
Genotype
Freq.

  Submitted individual genotype for ss5586192 back to top
There is no individual genotype data for ss5586192.