NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586193           
Submitter
HandleSNP500CANCER
Submitter SNP IDADH1C-01
RefSNP(rs#)rs698
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginG:Germline A:Germline
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TGAGAGAGAGAATAACTAAGGACCC, Temp: 51.4, GC Content:44, Product Size: 352 Primer R: TTTCCAGAGCGAAGCAGG, Temp: 51.4, GC Content:55.56
Platform: TaqMan Forward primer: AGCGAAGCAGGTCAAATCCTT, Amount: 900 nM Reverse primer: GCTAAGAAGTTTTCACTGGATGCAT, Amount: 900 nM Probe 1: TTCAAAAGGTAAAACATTT, Amount: 200 nM Probe 2: TTCAAAAGGTAAAATATTT, Amount: 200 nM Annealing temperature: 62 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586193|allelePos=120|len=273|taxid=9606|alleles='A/G'|mol=Genomic
 TGGTTGAATC TATCAATGAT ATTTTCTTCT TTTCAGGCTT TAAGAGTAAA GAATCTGTCC
 CSAAACTTGT GGCTGACTTT ATGGCTAAGA AGTTTTCACT GGATGCATTA ATAACAAAT
 R
 TTTTACCTTT TGAAAAAATA AATGAAGGAT TTGACCTGCT TCGCTCTGGA AAGAGGTAGA
 TTTTAAGTTG TTTTTTTGTT TTGCTTTGTA TTCTACAGTA GCGGCGKGGG GSGGGSGTTG
 TCTAGCAGAG AATGAAAAGG TGGAAGGATG AGA

  Submitted Frequency for ss5586193 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
44A=0.84100002
G=0.15899999
0.267 +/-0.106A/A=0.72700000
A/G=0.22700000
G/G=0.04600000
0.22708272003SNP500CANCER
AFR1
MULTI-NATIONAL
48A=0.93800002
G=0.06200000
0.116 +/-0.086A/A=0.87500000
A/G=0.12500000
G/G=0.00000000
0.12508272003SNP500CANCER
CAUC1
MULTI-NATIONAL
54A=0.51899999
G=0.48100001
0.499 +/-0.007A/G=0.44400001
A/A=0.29600000
G/G=0.25999999
0.44408272003SNP500CANCER
P1
MULTI-NATIONAL
192A=0.71899998
G=0.28099999
0.404 +/-0.040A/A=0.56300002
A/G=0.31299999
G/G=0.12400000
0.31308272003SNP500CANCER
HISP1
MULTI-NATIONAL
46A=0.60900003
G=0.39100000
0.476 +/-0.044A/G=0.43500000
A/A=0.39100000
G/G=0.17399999
0.43508272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586193 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586193.


  Submitted individual genotype for ss5586193 back to top
There is no individual genotype data for ss5586193.