NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586195           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-01
RefSNP(rs#)rs1136410
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec/t_g
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: GTTCTCAAAGGACCACCAG, Temp: 46.4, GC Content:52.63, Product Size: 417 Primer R: TGCCATTCACTGTGTTGG, Temp: 47.4, GC Content:50
Platform: TaqMan Forward primer: ACCTCGATGTCCAGCAGGTT, Amount: 700 nM Reverse primer: AGGCCAAGGcGGAAATGCTTG, Amount: 700 nM Probe 1: CAGGCCAAGGtGGAAATGCTTGA, Amount: 100 nM Probe 2: TGGACCTTCTCTGCATGTAGGTT, Amount: 100 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586195|allelePos=215|len=410|taxid=9606|alleles='C/T'|mol=Genomic
 CCCAGGCCAC AAGGCCTTGT TAACATTCCA GAAAGTCCTT ATGAGCTCTC AATATGTGCA
 GCAGGTAACA GGCTGGCCCT GACCAGCAGG AGGGTTTGCC ATTCACTGTG TTGGACCTTC
 TCTGCATGTA GGTTTTMTCT GCCACCTGGG TGAGTCTGTC TCATTCACCA TGATACCTAA
 GTCGGGGGCT TTCTTTTGCT CCTCCAGGCC AAGG
 Y
 GGAAATGCTT GACAACCTGC TGGACATCGA GGTGGCCTAC AGTCTGCTCA GGGGAGGGTC
 TGATGATAGC AGCAAGGATC CCATCGATGT CAACTATGAG AAGCTCAAAA CTGACATTAA
 GGTAACAGGG TCAGGCCTTC CTCAAGCATC TTAACCTCTC ATCCTGAGAG CAGCGGTCCC
 AAACTTCCAT GTGTG

  Submitted Frequency for ss5586195 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48T=0.66700000
C=0.33300000
0.444 +/-0.064T/T=0.54200000
C/T=0.25000000
C/C=0.20800000
0.25008272003SNP500CANCER
AFR1
MULTI-NATIONAL
48T=0.93699998
C=0.06300000
0.118 +/-0.087T/T=0.91600001
C/C=0.04200000
C/T=0.04200000
0.04208272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62T=0.88700002
C=0.11300000
0.200 +/-0.088T/T=0.77399999
C/T=0.22600000
C/C=0.00000000
0.22608272003SNP500CANCER
P1
MULTI-NATIONAL
204T=0.82800001
C=0.17200001
0.285 +/-0.049T/T=0.71600002
C/T=0.22499999
C/C=0.05900000
0.22508272003SNP500CANCER
HISP1
MULTI-NATIONAL
46T=0.80400002
C=0.19599999
0.315 +/-0.101T/T=0.60900003
C/T=0.39100000
C/C=0.00000000
0.39108272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586195 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586195.


  Submitted individual genotype for ss5586195 back to top
There is no individual genotype data for ss5586195.