NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586196           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-02
RefSNP(rs#)rs1805404
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: AACTGCTTACTTACTTCCC, Temp: 40.2, GC Content:42.11, Product Size: 360 Primer R: GAGGTGTTGCTGAAATAAC, Temp: 41.5, GC Content:42.11
Platform: TaqMan Forward primer: CTGCTGGTCATCC, Amount: 900 nM Reverse primer: GCTTCCGCTGTCTTCTTGACTT, Amount: 900 nM Probe 1: TGAGGTGGATGGGTTCTCTGA, Amount: 200 nM Probe 2: TGCTGATCATCCC, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586196|allelePos=213|len=460|taxid=9606|alleles='C/T'|mol=Genomic
 GGACTGGGGT CGAGGTCAAG GTCAAGGTCT AGTGGGTCTA AGTCAAAAGT TAACTGCTTA
 CTTACTTCCC TCTGTTTCTC TTCCTTCTAG TCGCCCATGT TTGATGGAAA AGTCCCACAC
 TGGTACCACT TCTCCTGCTT CTGGAAGGTG GGCCACTCCA TCCGGCACCC TGACGTTGAG
 GTGGATGGGT TCTCTGAGCT TCGGTGGGAT GA
 Y
 CAGCAGAAAG TCAAGAAGAC AGCGGAAGCT GGAGGAGTGA CAGGTGTGTA CATACTGGGG
 CAGCATGGGC ATTCAGCCCC CACCCTGAAG CTCCCAGGAG GGCCTCGTCT CAGAGAGCAA
 AGCARACCTC CCCCAGCTTG CCCTCTCCCA CATGTGCAGA TCAAGCGTAT GGTGCCCATG
 TTATTTCAGC AACACCTCCT GGACTCAGCA TCATCTGTTG CATGATATTT GGTATTTTGT
 TTTTCCA

  Submitted Frequency for ss5586196 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48C=0.66700000
T=0.33300000
0.444 +/-0.064C/C=0.54200000
C/T=0.25000000
T/T=0.20800000
0.25008272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.72899997
T=0.27100000
0.395 +/-0.083C/C=0.50000000
C/T=0.45800000
T/T=0.04200000
0.45808272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=0.88700002
T=0.11300000
0.200 +/-0.088C/C=0.77399999
C/T=0.22600000
T/T=0.00000000
0.22608272003SNP500CANCER
P1
MULTI-NATIONAL
204C=0.77499998
T=0.22499999
0.349 +/-0.045C/C=0.60799998
C/T=0.33300000
T/T=0.05900000
0.33308272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=0.78299999
T=0.21699999
0.340 +/-0.097C/C=0.56500000
C/T=0.43500000
T/T=0.00000000
0.43508272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586196 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586196.


  Submitted individual genotype for ss5586196 back to top
There is no individual genotype data for ss5586196.