NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586199           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-07
RefSNP(rs#)rs4986815
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/-
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassDIV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TCTGGTAAACAGGATGACGC, Temp: 50, GC Content:50, Product Size: 365 Primer R: TGTAGTCCCGCATTTGCC, Temp: 51.6, GC Content:55.56

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586199|allelePos=282|len=488|taxid=9606|alleles='A/-'|mol=Genomic
 TAGTGAGTGG AATCTGTGCA AGTTCCTCCA TCCCACATTA GTAAGTGTCC TTTTTTGTAG
 TCCCGCATTT GCCCTCTGAC RTGTTTCTCC ACTGGCTGCA GATCTTGGAC CGAGTAGCYG
 ATGGCATGGT GTTCGGTGCC CTCCTTCCCT GCGAGGAATG CTCGGGTCAG CTGGTCTTCA
 AGAGCGATGC CTATTACTGC ACTGGGGACG TCACTGCCTG GACCAAGTGT ATGGTCAAGA
 CACAGACACC CAACCGGAAG GAGTGGRTAA CCCCAAAGGT A
 N
 GGGGTAGGGG AAGATCCTGG GATCTGTTGG GAGAAAAACC TGGCCCCACT TTCTGCGCTT
 GTTTATACTT CAGGTCCCTG AGATTGCAGG GCCATGTTCC TCAGACTTCT TTACAGCTGC
 GTCATCCTGT TTACCAGAAT ATAAAATTAC ATGTTTGCAA ACTACGCAAA TGTAGAACCG
 AAGCTCCTCT AAGTATGGAG TAGAGG

  Submitted Frequency for ss5586199 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48-=1.00000000
+=0.00000000
-/-=1.00000000
+/-=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48-=0.97899997
+=0.02100000
0.041 +/-0.056-/-=0.95800000
+/-=0.04200000
0.04208272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62-=1.00000000
+=0.00000000
-/-=1.00000000
+/-=0.00000000
08272003SNP500CANCER
P1
MULTI-NATIONAL
204-=0.99500000
+=0.00500000
0.010 +/-0.014-/-=0.99000001
+/-=0.01000000
0.01008272003SNP500CANCER
HISP1
MULTI-NATIONAL
46-=1.00000000
+=0.00000000
-/-=1.00000000
+/-=0.00000000
08272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586199 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586199.


  Submitted individual genotype for ss5586199 back to top
There is no individual genotype data for ss5586199.