NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586200           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-08
RefSNP(rs#)rs1805408
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec_g/a
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 19
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TCTGGTAAACAGGATGACGC, Temp: 50, GC Content:50, Product Size: 365 Primer R: TGTAGTCCCGCATTTGCC, Temp: 51.6, GC Content:55.56
Platform: TaqMan Forward primer: CTGACGTGTTTCTC, Amount: 900 nM Reverse primer: GAAGGAGGGCACCGAACAC, Amount: 900 nM Probe 1: TCTGACATGTTTCTC, Amount: 200 nM Probe 2: TTTTTGTAGTCCCGCATTTGC, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586200|allelePos=207|len=513|taxid=9606|alleles='A/G'|mol=Genomic
 GGGGGCGCTG CAGGAACACT TGGAAATAAG GTCTCCTACA AGAATCCAAG CTCCATTGTA
 AACCAAGGGT GGGTGGGGTG TTAAGAGCCC CATAGCAAGC CCACAGCAAG AAGCCTCTCT
 TCTTTGTAGT GAGTGGAATC TGTGCAAGTT CCTCCATCCC ACATTAGTAA GTGTCCTTTT
 TTGTAGTCCC GCATTTGCCC TCTGAC
 R
 TGTTTCTCCA CTGGCTGCAG ATCTTGGACC GAGTAGCYGA TGGCATGGTG TTCGGTGCCC
 TCCTTCCCTG CGAGGAATGC TCGGGTCAGC TGGTCTTCAA GAGCGATGCC TATTACTGCA
 CTGGGGACGT CACTGCCTGG ACCAAGTGTA TGGTCAAGAC ACAGACACCC AACCGGAAGG
 AGTGGRTAAC CCCAAAGGTA AGGGGTAGGG GAAGATCCTG GGATCTGTTG GGAGAAAAAC
 CTGGCCCCAC TTTCTGCGCT TGTTTATACT TCAGGTCCCT GAGATTGCAG GGCCATGTTC
 CTCAGA

  Submitted Frequency for ss5586200 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48A=0.68800002
G=0.31200001
0.429 +/-0.071A/A=0.54200000
A/G=0.29200000
G/G=0.16599999
0.29208272003SNP500CANCER
AFR1
MULTI-NATIONAL
48A=0.64600003
G=0.35400000
0.457 +/-0.057A/G=0.45800000
A/A=0.41700000
G/G=0.12500000
0.45808272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62A=0.90300000
G=0.09700000
0.175 +/-0.086A/A=0.80599999
A/G=0.19400001
G/G=0.00000000
0.19408272003SNP500CANCER
P1
MULTI-NATIONAL
204A=0.77899998
G=0.22100000
0.344 +/-0.046A/A=0.62699997
A/G=0.30399999
G/G=0.06900000
0.30408272003SNP500CANCER
HISP1
MULTI-NATIONAL
46A=0.84799999
G=0.15200000
0.258 +/-0.104A/A=0.69599998
A/G=0.30399999
G/G=0.00000000
0.30408272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586200 back to top

Population ID
 -Class
Total
Sample
(2N)
Founder
(2N)
Major
Allele
Freq.
Minor
Allele
Freq.
Genotype
Freq.
HWE Goodness of FitData
Source
HapMap-CEU224224A=0.78571427
G=0.21428572A/A=0.62500000
A/G=0.32142857
G/G=0.05357143
Pr(chiSq=0.231,df=1)
=0.655
Genotype
Freq.
HapMap-HCB
EAST ASIA
8686A=0.69767439
G=0.30232558A/A=0.51162791
A/G=0.37209302
G/G=0.11627907
Pr(chiSq=0.598,df=1)
=0.479
Genotype
Freq.
HapMap-JPT172172A=0.75000000
G=0.25000000A/A=0.55813956
A/G=0.38372093
G/G=0.05813954
Pr(chiSq=0.047,df=1)
=1.000
Genotype
Freq.
HapMap-YRI226226A=0.57964599
G=0.42035398A/G=0.48672566
A/A=0.33628318
G/G=0.17699115
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.
HAPMAP-ASW9898A=0.64285713
G=0.35714287A/G=0.42857143
A/A=0.42857143
G/G=0.14285715
Pr(chiSq=0.218,df=1)
=0.655
Genotype
Freq.
HAPMAP-CHB8282A=0.73170733
G=0.26829270A/A=0.60975611
A/G=0.24390244
G/G=0.14634146
Pr(chiSq=5.883,df=1)
=0.020
Genotype
Freq.
HAPMAP-CHD170170A=0.67058825
G=0.32941177A/A=0.45882353
A/G=0.42352942
G/G=0.11764706
Pr(chiSq=0.145,df=1)
=0.752
Genotype
Freq.
HAPMAP-GIH176176A=0.78977275
G=0.21022727A/A=0.63636363
A/G=0.30681819
G/G=0.05681818
Pr(chiSq=0.509,df=1)
=0.479
Genotype
Freq.
HAPMAP-LWK180180A=0.57222223
G=0.42777777A/G=0.45555556
A/A=0.34444445
G/G=0.20000000
Pr(chiSq=0.434,df=1)
=0.527
Genotype
Freq.
HAPMAP-MEX100100A=0.86000001
G=0.14000000A/A=0.74000001
A/G=0.23999999
G/G=0.02000000
Pr(chiSq=0.001,df=1)
=1.000
Genotype
Freq.
HAPMAP-MKK276276A=0.74637681
G=0.25362319A/A=0.57246375
A/G=0.34782609
G/G=0.07971015
Pr(chiSq=0.912,df=1)
=0.343
Genotype
Freq.
HAPMAP-TSI176176A=0.82954544
G=0.17045455A/A=0.65909094
A/G=0.34090909
Pr(chiSq=1.159,df=1)
=0.294
Genotype
Freq.

  Submitted individual genotype for ss5586200 back to top
There is no individual genotype data for ss5586200.