NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586202           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-10
RefSNP(rs#)rs1805414
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec/t_g
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TCTGGTAAACAGGATGACGC, Temp: 50, GC Content:50, Product Size: 365 Primer R: TGTAGTCCCGCATTTGCC, Temp: 51.6, GC Content:55.56
Platform: TaqMan Forward primer: AGTAGCCGATGGCAT, Amount: 900 nM Reverse primer: AGTAGCTGATGGCATG, Amount: 900 nM Probe 1: CACTGGCTGCAGATCTTGGA, Amount: 200 nM Probe 2: GAAGGAGGGCACCGAACAC, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586202|allelePos=227|len=507|taxid=9606|alleles='C/T'|mol=Genomic
 CTTGGAAATA AGGTCTCCTA CAAGAATCCA AGCTCCATTG TAAACCAAGG GTGGGTGGGG
 TGTTAAGAGC CCCATAGCAA GCCCACAGCA AGAAGCCTCT CTTCTTTGTA GTGAGTGGAA
 TCTGTGCAAG TTCCTCCATC CCACATTAGT AAGTGTCCTT TTTTGTAGTC CCGCATTTGC
 CCTCTGACRT GTTTCTCCAC TGGCTGCAGA TCTTGGACCG AGTAGC
 Y
 GATGGCATGG TGTTCGGTGC CCTCCTTCCC TGCGAGGAAT GCTCGGGTCA GCTGGTCTTC
 AAGAGCGATG CCTATTACTG CACTGGGGAC GTCACTGCCT GGACCAAGTG TATGGTCAAG
 ACACAGACAC CCAACCGGAA GGAGTGGRTA ACCCCAAAGG TAAGGGGTAG GGGAAGATCC
 TGGGATCTGT TGGGAGAAAA ACCTGGCCCC ACTTTCTGCG CTTGTTTATA CTTCAGGTCC
 CTGAGATTGC AGGGCCATGT TCCTCAGACT TCTTTACAGC

  Submitted Frequency for ss5586202 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48C=0.66700000
T=0.33300000
0.444 +/-0.064C/C=0.58300000
T/T=0.25000000
C/T=0.16700000
0.16708272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.62500000
T=0.37500000
0.469 +/-0.049C/C=0.41700000
C/T=0.41700000
T/T=0.16599999
0.41708272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62T=0.79000002
C=0.20999999
0.332 +/-0.085T/T=0.58099997
C/T=0.41900000
C/C=0.00000000
0.41908272003SNP500CANCER
P1
MULTI-NATIONAL
204T=0.54900002
C=0.45100001
0.495 +/-0.010C/T=0.37300000
T/T=0.36199999
C/C=0.26499999
0.37308272003SNP500CANCER
HISP1
MULTI-NATIONAL
46T=0.63000000
C=0.37000000
0.466 +/-0.052C/T=0.47799999
T/T=0.39199999
C/C=0.13000000
0.47808272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586202 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586202.


  Submitted individual genotype for ss5586202 back to top
There is no individual genotype data for ss5586202.