NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586204           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-12
RefSNP(rs#)rs1805415
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 9
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TGACGGATACTTTCTTCACC, Temp: 46.5, GC Content:45, Product Size: 316 Primer R: TGGTTACCTCAAGGGAGAG, Temp: 46.3, GC Content:52.63
Platform: TaqMan Forward primer: AATTCCGAGAAATCTCTTACCTCAAG, Amount: 900 nM Reverse primer: ACGGAGGCGCTGGTTTC, Amount: 900 nM Probe 1: CGGTCCTGCTTTT, Amount: 200 nM Probe 2: CGGTCCTGTTTTT, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586204|allelePos=449|len=1097|taxid=9606|alleles='A/G'|mol=Genomic
 CCCACAGAGG CCTATTAACT CTCGAAGGGA GCAACTCAGG AATGAGGCCA GGGAGGTTGT
 AGTCATACAG CAGTTCCAGT GGTGGTTCCC TGACCGAATT GGCCACTGGT TTCTGTTTTT
 GTTTTTTTTA GGGAAAGATT TTTCTCTTAA AGCAGCCACA ATATTAGCCC TATTATAAAT
 GTAAAAGTAC CGGAAATAAG TACTGTAGCA GCAATAATAC TGTCTTTCAT CCTTAAAGCC
 TCACATTTTT CTATTTTTTG TTACTCTTTA TTGTAAGAAG AAAAAAAGAG ATTATTTGAT
 TKGGACAAGC CAAATCCTCT TTGGTCTATG GGGTGGTTAC CTCAAGGGAG AGCTGGCTTC
 TTAACTAAAA CTTAATATTT TTTAGGAATT CTAATATTTT TTAGGAATTC CGAGAAATCT
 CTTACCTCAA GAAATTGAAG GTTAAAAA
 R
 CAGGACCGTA TATTCCCCCC AGAAACCAGC GCCTCCGTGG CGGCCACGCC TCCGCCCTCC
 ACAGCCTCGG CTCCTGCTGC TGTGAACTCC TMTGCTTCAG CAGGTACAGC ATTTGGGACC
 CCGGTCTTAG AGCTGCTTTG CAGGAATTGT TTGCCCACTA CTTGCTGGTG GTGTGGAGCT
 GGTGAAGAAA GTATCCGTCA AGGGTCTCTC TTTGCTGACC CCACCATGGG GAAGCCTTGC
 CCTGCAGGGG ATAGGCCTCT TCTCTTGGCT TGTTACACCC CTGACCACAG CAAGGTGGGA
 GAGTGTTAAG AACATAGCAT Cggctgggag cagtgactca cacctgtaat cccagcactt
 taggaagctg aggcaaaaga attgctgagg ccaggagttt gagaccaacc tgggcaatgt
 agtgagaccc catctctaca aaaatgttta aaattaatcc gagtatgtgc ctttagccct
 agatactcag gaggctgagg cggaggatcc cttgagcctg ggaggtcaag gctgcactga
 gctatgatca cgctaatgca caccagcttg ggcgatggag tgatacccta tctctaaaaa
 taaaataaaC ATTGTAGAAG AACAAGCAGC TCTTACTCTG GGAGGCTA

  Submitted Frequency for ss5586204 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48G=0.66700000
A=0.33300000
0.444 +/-0.064G/G=0.54200000
A/G=0.25000000
A/A=0.20800000
0.25008272003SNP500CANCER
AFR1
MULTI-NATIONAL
48G=0.79200000
A=0.20800000
0.329 +/-0.097G/G=0.62500000
A/G=0.33300000
A/A=0.04200000
0.33308272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62G=0.88700002
A=0.11300000
0.200 +/-0.088G/G=0.77399999
A/G=0.22600000
A/A=0.00000000
0.22608272003SNP500CANCER
P1
MULTI-NATIONAL
200G=0.79500002
A=0.20500000
0.326 +/-0.048G/G=0.64999998
A/G=0.28999999
A/A=0.06000000
0.29008272003SNP500CANCER
HISP1
MULTI-NATIONAL
42G=0.81000000
A=0.19000000
0.308 +/-0.106G/G=0.61900002
A/G=0.38100001
A/A=0.00000000
0.38108272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586204 back to top

Population ID
 -Class
Total
Sample
(2N)
Founder
(2N)
Major
Allele
Freq.
Minor
Allele
Freq.
Genotype
Freq.
HWE Goodness of FitData
Source
HapMap-CEU120120G=0.83333331
A=0.16666667G/G=0.69999999
A/G=0.26666668
A/A=0.03333334
Pr(chiSq=0.096,df=1)
=1.000
Genotype
Freq.
HapMap-HCB
EAST ASIA
8888G=0.52272725
A=0.47727272A/G=0.63636363
G/G=0.20454545
A/A=0.15909091
Pr(chiSq=3.336,df=1)
=0.100
Genotype
Freq.
HapMap-JPT8888G=0.56818181
A=0.43181819G/G=0.38636363
A/G=0.36363637
A/A=0.25000000
Pr(chiSq=2.950,df=1)
=0.100
Genotype
Freq.
HapMap-YRI120120G=0.90833336
A=0.09166667G/G=0.83333331
A/G=0.15000001
A/A=0.01666667
Pr(chiSq=0.591,df=1)
=0.479
Genotype
Freq.

  Submitted individual genotype for ss5586204 back to top
There is no individual genotype data for ss5586204.