NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586205           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-13
RefSNP(rs#)rs747657
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleC/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: CCAAACAACAACAACAACGC, Temp: 51.4, GC Content:45, Product Size: 379 Primer R: CCAGAAACTCAGGAGGGAG, Temp: 48.4, GC Content:57.89
Platform: TaqMan Forward primer: CCAACAGTTTCATTAGG, Amount: 900 nM Reverse primer: CCAACAGTTTGATTAGG, Amount: 900 nM Probe 1: CTTCACACTGGGCTCTCGAAA, Amount: 200 nM Probe 2: GGGTTTTGTGGACTTTTATCTCATCT, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586205|allelePos=433|len=1053|taxid=9606|alleles='C/G'|mol=Genomic
 GATGATCCCC CAGGCCGCCT CCTCCACTCA CCAGTGTTTC AGTTTTCTTA GACCAACCCA
 AATGGAACTG GAATTTTAAT TCCACTTCCA GATTCTCCAT AGAGAAAGAT CTGATTAGTC
 CAGCTTGATT TGGACATCGA CCCTAGTCCT GTGAACTGTA ACCAAAAGCA CAAGGTCATG
 TAAAAGGCCA GGGGTCTGGG GACTGTGGAA TGTGGACGGA AACCTAGAGC TGCTGACCAC
 CACTCCAAAT AGGGCCTTGC CTTGAAAATG GCCCCATAGC AGTGATCGCT GGGCACAAAC
 TATGTTCAGC CGCAACTGCA GTTTCAGGTT CTGGAACAGT TCCAGAAACT CAGGAGGGAG
 CCTGAGCAGT TTAGATGGTC TGGGTTTTGT GGACTTTTAT CTCATCTCTG TATCTGATCT
 TATTCTCCTA AT
 S
 AAACTGTTGG TTTCGAGAGC CCAGTGTGAA GGCCTCTTCT GAGACTGTCC TCTTTTGAAT
 AGGTATGAAC TGAAGCACGC TTCACATATC AGCARGTTAC CCAAGGGCAA GCACAGTGTC
 AAAGGTAAAG TGTTTCCAAA GCTGTTGCTA CAGCCCGAGG CACCCTGGAC AGCACAGAAG
 CCRGGGGCTT GCTGTCCTGA GAAGGCTGCC TTGTGGCTGG CTGTCAAACA GCTGGAGATT
 CATTTTATCT TTTCGAGGGG TGTGTGTGCG TTGTTGTTGT TGTTTGGGGG GTGGTGGTGG
 TGGTTAATAT GCTGCAACTG ACCATGATTG GAGGTTCatt ttatttattt ttgtaaaaaa
 aaaaaaaaaa taGGCAAGCT CTATAGCAGG AGGTTCATTT TTAAAAACAG TTCACTCTCT
 GTGGCTGCAG CTGGTATCAC AGATGCCACA GGAGAATCTT GGTGCAGGCA CCAGTAACCA
 GATGCACGGG TTTCGGCTTT AACCTAACTT GTAGCTACAG CAGTGAGGGA CCTCTCGTGA
 CATAGTAGTG CCTGGAGCAT CTTGGATTGC TAGAATTTGC AGCATATGAT TTAGAACCTT
 CCACTGCCTG GTTGAAGTGG

  Submitted Frequency for ss5586205 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48C=0.66700000
G=0.33300000
0.444 +/-0.064C/C=0.58300000
G/G=0.25000000
C/G=0.16700000
0.16708272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.60399997
G=0.39600000
0.478 +/-0.042C/G=0.45800000
C/C=0.37500000
G/G=0.16700000
0.45808272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62G=0.79000002
C=0.20999999
0.332 +/-0.085G/G=0.58099997
C/G=0.41900000
C/C=0.00000000
0.41908272003SNP500CANCER
P1
MULTI-NATIONAL
204G=0.54900002
C=0.45100001
0.495 +/-0.010C/G=0.39199999
G/G=0.35299999
C/C=0.25500000
0.39208272003SNP500CANCER
HISP1
MULTI-NATIONAL
46G=0.60900003
C=0.39100000
0.476 +/-0.044C/G=0.52200001
G/G=0.34799999
C/C=0.13000000
0.52208272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586205 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586205.


  Submitted individual genotype for ss5586205 back to top
There is no individual genotype data for ss5586205.