NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586206           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-14
RefSNP(rs#)rs747659
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec_g/a
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 17
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: CCAAACAACAACAACAACGC, Temp: 51.4, GC Content:45, Product Size: 379 Primer R: CCAGAAACTCAGGAGGGAG, Temp: 48.4, GC Content:57.89

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586206|allelePos=429|len=1071|taxid=9606|alleles='A/G'|mol=Genomic
 CCAGGGGTCT GGGGACTGTG GAATGTGGAC GGAAACCTAG AGCTGCTGAC CACCACTCCA
 AATAGGGCCT TGCCTTGAAA ATGGCCCCAT AGCAGTGATC GCTGGGCACA AACTATGTTC
 AGCCGCAACT GCAGTTTCAG GTTCTGGAAC AGTTCCAGAA ACTCAGGAGG GAGCCTGAGC
 AGTTTAGATG GTCTGGGTTT TGTGGACTTT TATCTCATCT CTGTATCTGA TCTTATTCTC
 CTAATYAAAC TGTTGGTTTC GAGAGCCCAG TGTGAAGGCC TCTTCTGAGA CTGTCCTCTT
 TTGAATAGGT ATGAACTGAA GCACGCTTCA CATATCAGCA RGTTACCCAA GGGCAAGCAC
 AGTGTCAAAG GTAAAGTGTT TCCAAAGCTG TTGCTACAGC CCGAGGCACC CTGGACAGCA
 CAGAAGCC
 R
 GGGGCTTGCT GTCCTGAGAA GGCTGCCTTG TGGCTGGCTG TCAAACAGCT GGAGATTCAT
 TTTATCTTTT CGAGGGGTGT GTGTGCGTTG TTGTTGTTGT TTGGGGGGTG GTGGTGGTGG
 TTAATATGCT GCAACTGACC ATGATTGGAG GTTCatttta tttatttttg taaaaaaaaa
 aaaaaaataG GCAAGCTCTA TAGCAGGAGG TTCATTTTTA AAAACAGTTC ACTCTCTGTG
 GCTGCAGCTG GTATCACAGA TGCCACAGGA GAATCTTGGT GCAGGCACCA GTAACCAGAT
 GCACGGGTTT CGGCTTTAAC CTAACTTGTA GCTACAGCAG TGAGGGACCT CTCGTGACAT
 AGTAGTGCCT GGAGCATCTT GGATTGCTAG AATTTGCAGC ATATGATTTA GAACCTTCCA
 CTGCCTGGTT GAAGTGGCCG CTTTGAAATT CTATTGAGCC GAAATGTGAT CCTGTAGGGA
 GGGTACTGCC ACTGTTCTCA TTAAACTCAG TGAAGGTTGA TGCCCTGGGA ACTTTGGTTT
 ATTGCCTTAG TTTTATATCT GAAGAAAGAT AGAGcatgtc tttaaaatga gcacatgagg
 ctgggtgtgg tggatcacct gaggtcagga gttcgagacc aT

  Submitted Frequency for ss5586206 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48C=0.68800002
T=0.31200001
0.429 +/-0.071C/C=0.54200000
C/T=0.29200000
T/T=0.16599999
0.29208272003SNP500CANCER
AFR1
MULTI-NATIONAL
48C=0.64600003
T=0.35400000
0.457 +/-0.057C/T=0.45800000
C/C=0.41700000
T/T=0.12500000
0.45808272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62C=0.90300000
T=0.09700000
0.175 +/-0.086C/C=0.80599999
C/T=0.19400001
T/T=0.00000000
0.19408272003SNP500CANCER
P1
MULTI-NATIONAL
204C=0.77899998
T=0.22100000
0.344 +/-0.046C/C=0.62699997
C/T=0.30399999
T/T=0.06900000
0.30408272003SNP500CANCER
HISP1
MULTI-NATIONAL
46C=0.84799999
T=0.15200000
0.258 +/-0.104C/C=0.69599998
C/T=0.30399999
T/T=0.00000000
0.30408272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586206 back to top

Population ID
 -Class
Total
Sample
(2N)
Founder
(2N)
Major
Allele
Freq.
Minor
Allele
Freq.
Genotype
Freq.
HWE Goodness of FitData
Source
P1
MULTI-NATIONAL
203203.999996185303C=0.77899998
T=0.22100000C/C=0.62699997
C/T=0.30399999
T/T=0.06900000
Pr(chiSq=1.399,df=1)
=0.251
Genotype
Freq.
CAUC1
MULTI-NATIONAL
6162C=0.90300000
T=0.09700000C/C=0.80599999
C/T=0.19399999
T/T=0.00000000
Pr(chiSq=0.358,df=1)
=0.584
Genotype
Freq.
AFR1
MULTI-NATIONAL
4748C=0.64599997
T=0.35400000C/T=0.45800003
C/C=0.41699997
T/T=0.12500000
Pr(chiSq=0.000,df=1)
=1.000
Genotype
Freq.
HISP1
MULTI-NATIONAL
4545.9999990463257C=0.84799999
T=0.15200001C/C=0.69599998
C/T=0.30399999
T/T=0.00000000
Pr(chiSq=0.739,df=1)
=0.403
Genotype
Freq.
PAC1
MULTI-NATIONAL
4747.9999985694885C=0.68800002
T=0.31200001C/C=0.54200000
C/T=0.29200000
T/T=0.16599999
Pr(chiSq=2.455,df=1)
=0.150
Genotype
Freq.
HapMap-CEU116116G=0.77586210
A=0.22413793G/G=0.62068963
A/G=0.31034482
A/A=0.06896552
Pr(chiSq=0.673,df=1)
=0.439
Genotype
Freq.
HapMap-HCB
EAST ASIA
8080G=0.67500001
A=0.32499999G/G=0.47499999
A/G=0.40000001
A/A=0.12500000
Pr(chiSq=0.312,df=1)
=0.584
Genotype
Freq.
HapMap-JPT164164G=0.73780489
A=0.26219511G/G=0.54878050
A/G=0.37804878
A/A=0.07317073
Pr(chiSq=0.043,df=1)
=1.000
Genotype
Freq.
HapMap-YRI216216G=0.58333331
A=0.41666666A/G=0.50000000
G/G=0.33333334
A/A=0.16666667
Pr(chiSq=0.088,df=1)
=1.000
Genotype
Freq.
HAPMAP-ASW9898G=0.65306121
A=0.34693879A/G=0.44897959
G/G=0.42857143
A/A=0.12244898
Pr(chiSq=0.004,df=1)
=1.000
Genotype
Freq.
HAPMAP-CHB8282G=0.73170733
A=0.26829270G/G=0.60975611
A/G=0.24390244
A/A=0.14634146
Pr(chiSq=5.883,df=1)
=0.020
Genotype
Freq.
HAPMAP-CHD166166G=0.67469877
A=0.32530120G/G=0.46987951
A/G=0.40963855
A/A=0.12048193
Pr(chiSq=0.370,df=1)
=0.584
Genotype
Freq.
HAPMAP-GIH170170G=0.76470590
A=0.23529412G/G=0.58823532
A/G=0.35294119
A/A=0.05882353
Pr(chiSq=0.031,df=1)
=1.000
Genotype
Freq.
HAPMAP-LWK174174G=0.58045977
A=0.41954023A/G=0.40229884
G/G=0.37931034
A/A=0.21839081
Pr(chiSq=2.634,df=1)
=0.150
Genotype
Freq.
HAPMAP-MEX9898G=0.84693879
A=0.15306123G/G=0.71428573
A/G=0.26530612
A/A=0.02040816
Pr(chiSq=0.027,df=1)
=1.000
Genotype
Freq.
HAPMAP-MKK284284G=0.73239434
A=0.26760563G/G=0.56338030
A/G=0.33802816
A/A=0.09859155
Pr(chiSq=2.691,df=1)
=0.150
Genotype
Freq.

  Submitted individual genotype for ss5586206 back to top
There is no individual genotype data for ss5586206.