NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586207           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP1-15
RefSNP(rs#)rs1805403
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/G
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG Codec_g/a
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: MGB Eclipse Forward primer: CCCGCAGTGCTCCA, Amount: 100 nM Reverse primer: CCGCAGCGCTCCA, Amount: 2000 nM Probe 1: GAGGAGTGGTATGGAACCTGTA Probe 2: TCCCAGGAGTCAAGAGTGAA Annealing temperature: 58 C
Platform: Sequencing Primer F: CACATCTCTGCTGTCACCATTCC, Temp: 55.9, GC Content:52.17, Product Size: 425 Primer R: TTCACTATCCTTGCTTGTCGCTC, Temp: 55.2, GC Content:47.83

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586207|allelePos=192|len=443|taxid=9606|alleles='A/G'|mol=Genomic
 GGAGAAGCCA CAGCTAGGCA TGATTGACCG CTGGTACCAT CCAGGCTGCT TTGTCAAGAA
 CAGGGAGGAG CTGGGTTTCC GGCCCGAGTA CAGTGCGAGT CAGCTCAAGG GCTTCAGCCT
 CCTTRCTACA GAGGATAAAG AAGCCCTGAA GAAGCAGCTC CCAGGAGTCA AGAGTGAAGG
 GTGGGTGGAG C
 R
 CTGCGGGGTT GCCCTGGGGG TTCAGTGAGG GGTTCAAGGG AGGCCCAAAG GMCCTACAGG
 TTCCATACCA CTCCTCTGTT TCCCTTCGCT GACTGTCAGT AAGCCAGGGA GATGCAAACT
 GAGGAATGGT GACAGCAGAG ATGTGGGGGC AAAGGACAGG GTAGGGAAAG ACAGCCAGGG
 GTTCCCATGG CCTCTGCTGA GAGCCCTCTC CCCTGTGAGA CCTGCTTCCT GGTGGTCTAT
 TCCCCTTCCA A

  Submitted Frequency for ss5586207 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
48G=0.97899997
A=0.02100000
0.041 +/-0.056G/G=0.95800000
A/G=0.04200000
A/A=0.00000000
0.04208272003SNP500CANCER
AFR1
MULTI-NATIONAL
48G=0.95800000
A=0.04200000
0.080 +/-0.075G/G=0.91700000
A/G=0.08300000
A/A=0.00000000
0.08308272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62G=0.77399999
A=0.22600000
0.350 +/-0.082G/G=0.61199999
A/G=0.32300001
A/A=0.06500000
0.32308272003SNP500CANCER
P1
MULTI-NATIONAL
204G=0.85799998
A=0.14200000
0.244 +/-0.049G/G=0.74599999
A/G=0.22499999
A/A=0.02900000
0.22508272003SNP500CANCER
HISP1
MULTI-NATIONAL
46G=0.73900002
A=0.26100001
0.386 +/-0.088G/G=0.52200001
A/G=0.43500000
A/A=0.04300000
0.43508272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586207 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586207.


  Submitted individual genotype for ss5586207 back to top
There is no individual genotype data for ss5586207.