NCBI
dbSNP

dbVar ClinVar GaP PubMed Nucleotide Protein
Search small variations in dbSNP or large structural variations in dbVar
transparent GIF
Spacer gif
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
Submitted SNP(ss) Details: ss5586210           
Submitter
HandleSNP500CANCER
Submitter SNP IDPARP4-03
RefSNP(rs#)rs1130941
Submitted Batch ID08272003_update
Submitted DateOct 28, 2003
Publication CitedN.D.
First entry to dbSNPSep 26 2002 12:00:00:000AM
Assay
SpeciesHomo sapiens
Molecular
Type
Genomic
MethodSEQUENCING
Ascertainment Samplesize204
PopulationP1
Allele
Observed AlleleA/T
Ancestral AlleleN.D.
Allele OriginN/A
SNP ClassSNV
CpG CodeUnknown
Validation
Validation StatusbyFreq
HWE Goodness of Fitnot applicable
Variation
Frequency Submissionpopulation count: 5
Genotype Summarypopulation count: 5
Genotype SubmissionN.D.
HaplotypeN.D.
Comment
Platform: Sequencing Primer F: TATTTCACTTTTCAACCACG, Temp: 45.4, GC Content:35, Product Size: 363 Primer R: ACAGGATACAGTAGAGAAGATTTG, Temp: 46.2, GC Content:37.5
Platform: TaqMan Forward primer: AATTCATTTTCAGTGATACACAT, Amount: 900 nM Reverse primer: CAAAGATGCACTAACCTTTTGTTTCAGT, Amount: 900 nM Probe 1: CATTTTCAGTGATACTCAT, Amount: 200 nM Probe 2: GCTAGCTTCTCTTTGACTATGTCTATTGA, Amount: 200 nM Annealing temperature: 60 C

  Fasta sequence   (Legend) back to top
>gnl|dbSNP|ss5586210|allelePos=213|len=404|taxid=9606|alleles='A/T'|mol=Genomic
 ACAAAGCAAA GGTTAGTACC TAAAATATAA AACCTGTCAA TTCAATGGAT ATTGGTTTTC
 TGGTTTAAAT TTCCATTTAG AATTGTTTGA AATAATTTCA GATAGAAATT TAAGATYGTA
 GASTAAGACA ACTTTCTCTT CATTTTTGCT AGCTTCTCTT TGACTATGTC TATTGAGATG
 CYGTAYGTGA TTGAATTCAT TTTCAGTGAT AC
 W
 CATGAACTGA AACAAAAGGT TAGTGCATCT TTGATTTCTT AAGAGCTGTT ATTTTAACAC
 TACTTTTATC TTATCAAAGC AATGTATGCA CGTGGTTGAA AAGTGAAATA ATGCTGACAA
 AACTTCTAAC AAGAAGCACT ACTCCTGCCC CTGATTCTCC CCAGACCAGT TTCCAGAGAC
 AGTGAATCAT T

  Submitted Frequency for ss5586210 back to top

Population ID
 -Class
Sample
(2n)
Major
Allele
Freq.
Minor
Allele
Freq.
Estimated
Heterozygosity
+/-std.err.
Genotype
Freq.
Submitted
Hetero-
zygosity
Submission
Batch
Submitter
PAC1
MULTI-NATIONAL
46A=1.00000000
T=0.00000000
A/A=1.00000000
A/T=0.00000000
T/T=0.00000000
08272003SNP500CANCER
AFR1
MULTI-NATIONAL
48A=0.83300000
T=0.16700000
0.278 +/-0.101A/A=0.70800000
A/T=0.25000000
T/T=0.04200000
0.25008272003SNP500CANCER
CAUC1
MULTI-NATIONAL
62A=0.90300000
T=0.09700000
0.175 +/-0.086A/A=0.80599999
A/T=0.19400001
T/T=0.00000000
0.19408272003SNP500CANCER
P1
MULTI-NATIONAL
202A=0.92600000
T=0.07400000
0.137 +/-0.044A/A=0.86100000
A/T=0.12899999
T/T=0.01000000
0.12908272003SNP500CANCER
HISP1
MULTI-NATIONAL
46A=0.97799999
T=0.02200000
0.043 +/-0.058A/A=0.95700002
A/T=0.04300000
T/T=0.00000000
0.04308272003SNP500CANCER


  dbSNP summary of Genotypes for ss5586210 back to top
No sufficient data to compute Hardy-weinberg probability for ss5586210.


  Submitted individual genotype for ss5586210 back to top
There is no individual genotype data for ss5586210.